Share

This post as reached the too long; didn’t email point. Please consider reading this post within the Substack app or on the website.

Two recent papers published in Science has led to much-needed discussion around the nature of COVID vaccines. In particular, the two studies highlight a critical factor in vaccination that has been overlooked these past few years. That is, the route of vaccine administration is just as, if not more important, than the type of vaccine platform used.

This idea has been raised several times during the pandemic, but it didn’t appear to gain much traction in either COVID zealot or COVID critic circles. I do recall responding to a comment on one of my posts and suggesting that if a vaccine should mimic an infection, we should consider mimicking the route of infection.

This isn’t some groundbreaking idea I might add. In a general sense this should seem intuitive. You would want to prevent an infection from being able to take hold in the first place rather than boosting the means of fighting of an already well-established infection.

If we were to analogize the body as akin to a castle it wouldn’t make sense to send guards to patrol around the kingdom while leaving the front gates unmanned. If enemies are expected to come from the front gates, then the best course of action would be to guard the front gates.

From an immunological perspective targeting mucosal immunity would confer the best mode of protection by both blocking the entry of pathogens into the body while also prevent transmission of infectious agents to other individuals. Neutralizing antibodies released form one’s mucosa can prevent entryway of pathogens into cells along the respiratory tract, as well as into tissues and cells found in more distal parts of the body. And this blockade also works to prevent entryway into other individuals as well- it stops the pathogen from accessing your body as well as the bodies of those around you.

Again, this is a concept that should seem intuitive for most individuals, and yet the standard route of vaccination is incongruent with this intuition.

This has been highlighted in several papers published during the pandemic, including one from Frontiers published in 20221 which states the problem with this incongruency in infection and vaccination:

In the first place, SARS-CoV-2 is an infection of the upper respiratory tract (URT) mucosae, i.e., the nasal passages and oropharynx. Only later, when, or indeed if, the virus reaches the lower respiratory tract (LRT) and lungs does it cause the severe acute respiratory syndrome known as COVID-19. It is an airborne infection mostly acquired by inhalation of virus-containing droplets and aerosols into the nose or mouth, or via the conjunctiva of the eyes and drainage into the nasal passages through the lacrimal duct. Enteric infection can also occur, although the quantitative impact of this in the current pandemic is uncertain (1), and it remains predominantly a respiratory infection (2).

The problem is further compounded by the fact that most neutralizing antibody studies rely on circulating antibodies from the blood, which doesn’t tell us much about what is going on within the mucosa:

These two sets of facts should elicit serious attention to mucosal immunity against SARS-CoV-2 (7), yet immunologists have been focused almost exclusively on the evaluation of circulating antibodies, predominantly of the IgG isotype, on cytotoxic T cells, and to a lesser extent on innate mechanisms of immunity. This has been driven in part by the need to develop, as rapidly as possible, treatments as well as vaccines to forestall serious disease and death. To a large extent, this has now been accomplished by the extraordinarily rapid development of several injectable vaccines, which are having a major effect on the outcomes of the pandemic.

Now, part of this incongruency lies in the fact that mucosal vaccines may have difficulty in eliciting an immune response due to the nature of the mucosal environment- the physical and immunological barriers that prevent pathogens may work against vaccines as well.2

But a more serious issue lies in the fact that there’s a false assumption that intramuscular immunization will eventually result in robust mucosal immunity- the guards randomly patrolling the streets will happen to come across the unattended front gates and decide to help guard that area.

Unfortunately, the latter assumption has been used extensively to argue in favor of intramuscular vaccination, and yet it’s the method of immunization that is most likely to carry greater risk of adverse events as it provides vaccine-related agents direct routes of entry into the body.

And so not only is there a question if mucosal vaccines will provide the best protection against respiratory infections, but this also raises a question if many of the adverse events associated with intramuscular vaccines would be mitigated by just changing the route of immunization. Imagine all the unnecessary harm that could have been avoided if we focused on the nose...

This brings us to the two recent studies, which begs the latter point made above- have the intramuscular SARS-COV2 vaccines provided robust mucosal immunity, or is this an area of fault that has never been properly addressed?

Both studies have garnered attention due to their contradictory findings:

One study comes from Lasrado, et al.3 with the authors’ findings suggesting that those who received the XBB 1.5 mRNA COVID booster vaccine in 2023 did not produce any detectable level of antibodies within the nasal mucosa of participants.

In contrast, a study from Declercq, et al.4 argued the opposite, suggesting that those who received a COVID mRNA booster showed evidence of neutralizing antibodies within their mucosal membranes.

First off, when two studies present contradictory findings, it becomes important to examine the differences in methodology. That being said, I highly suggest that readers do not look to news sources for those differences in methodology as you will only get the most general and ambiguous of explanations.

Surprisingly, Science published a focus article5 that looked at the differences in methodology. I encourage readers to check out that article, although I will point out several of the main methodological discrepancies here.

The following figure is a helpful summary comparing the findings of both studies for those who may find the following information confusing:

Heterogeneous study designs

For one, note that the Lasrado, et al. study used an extremely heterogeneous study group. Many of the individuals in the study had multiple COVID vaccines including boosters prior to receiving the XBB 1.5 booster, had heterologous immunizations (i.e. a mix of the Pfizer, Moderna, and the J&J platforms), as well as having evidence of having prior SARS-COV2 infections.

Participants had a median of four COVID-19 vaccines, and ~80% of participants had a history of prior COVID-19 infection, although this might be an underestimate because of the high frequency of asymptomatic or minimally symptomatic infections.

Also, the authors were examining the effects of the XBB 1.5 booster on mucosal immunity, and thus had a later timeline relative to the Declercq, et al. study. Thus, the heterogeneous nature of the study isn’t particular surprising. However, it makes for a messy comparison even among participants of the same study as it introduces several confounders including different variant exposures as well as different timeframes between doses and sample collection. Note that there are no measures of antibody titers prior to receiving any vaccines/infections- the baseline measured in this study is a baseline at the time of the receiving the XBB 1.5 booster.

The Declercq, et al. study doesn’t indicate who among the participants may have had prior COVID infections-this is only inferred through examination for anti-N antibodies of participants- and so prior infections could explain some evidence of mucosal antibodies. Although it included heterologous vaccinees the participants who received boosters received mRNA vaccines encoding the original spike sequence. Researchers also collected samples prior to participants receiving any vaccinations, and thus provides a more accurate baseline representation of the participants barring the issues of identifying participants with prior SARS-COV2 exposure. Note here that the timeline of both serum and nasal sample collection was more detailed:

We obtained sera and nasal secretions from study participants before COVID-19 vaccination, 2 to 4 weeks and 6 months after two vaccine doses, and 2 to 4 weeks and 6 months after booster vaccination. Primary vaccination included either two doses of the Pfizer-BioNTech BNT162b2 mRNA-based vaccine or two doses of the AstraZeneca ChAdOx1 nCov-19 AVV-based vaccine. Booster vaccination was performed with an mRNA-based vaccine [Pfizer-BioNTech BNT162b2 (n = 134) or Moderna mRNA-1273 (n = 8)].

What also stands out is the method of nasal sample collection.

Lasrado, et al. collected samples via nasal swabs:

The specimen biorepository at Beth Israel Deaconess Medical Center (BIDMC) obtained peripheral blood and nasal swabs from the study participants. 

There’s no indication for what standard was used, such as time swabbed, intensity of swabbing, and method of swab storage.

In contrast, Declercq, et al. placed sinus packs into the sinuses of participants for five minutes before resuspension in a saline solution stored in tubes and incubated:

Briefly, sinus packs were placed in the nasal cavity for 5 min and subsequently transferred to a 15-ml tube. Two milliliters of physiologic saline (0.9% NaCl) was added, whereafter the sinus packs were incubated at 4°C for 2 hours. Next, sinus packs were transferred in 5-ml syringes, which were consequently put in a 15-ml tube and centrifuged.

Not sure if 5 minutes counts as “briefly”, but nonetheless it’s clear that nasal sample collection is different between the two studies with Declercq, et al.’s likely being more comprehensive. The lack of detecting neutralizing antibodies in the Lasrado, et al. study could represent a poorer method of sample collection.

Note that there is no standard for nasal sample collection method, which unfortunately means that most studies examining mucosal immunity may find conflicting results due to heterogeneous sampling methodologies. This issue can certainly be seen here in which the use of long-held sinus packs may allow for greater absorbance of mucosal antibodies, and therefore would be more detectable in assays.

This same issue doesn’t occur with blood collection which is far more consistent, and possibly why serum antibody levels have been relied on so heavily as a measure for immunity since it allows for more controlled comparisons across immunization studies.

There are differences among the assays utilized in both studies and so differences in sensitivity and data interpretation could also explain the discrepancies in results. Looking into nuances of the assays used will be far too complex for the intext of this post- just bear in mind that this could be one explanation for the differences findings.

So overall the main issue lies in the heterogeneity of study participants across the two studies which consists of differences in timing of sample collection, type of boosters administered, method of nasal sample collection, etc.

What’s going on in the nose?

Focusing on the results of the nasal antibody portion of both studies Lasrado, et al. noticed no statistically significant differences in nasal neutralizing antibody levels before and 3 weeks after receiving the XBB 1.5 booster.

(E) looks specifically at those who received the XBB 1.5 booster and their neutralizing capacity for different variants while (F) looks at those who did not receive the booster, possibly serving as a metric to see if antibody titers decline over time and likely served as a comparator for the Week 3 post-booster measures.

Bear in mind that the study isn’t measuring if there are any neutralizing antibody titers in the nose, but rather if boosting would increase the number of antibodies relative to baseline. Here, the data doesn’t appear to suggest that any significant changes in neutralizing capacity occurred as can be noticed by the “4” above each SARS-COV2 variant graph. In fact, many of the individuals in this study appear to show no evidence of nose-related neutralizing antibodies as can be seen by the red line at the bottom of the graphs which denotes the median neutralizing antibody titers of participants.

Bear in mind that these results are relative to the sample collection and assays used in this study.

What’s interesting here is that a few people showed very high levels of neutralizing antibody titers prior to receiving the booster. Given the limited information provided on the participants it’s possible that these higher titers could be due to prior infections, and in some rare cases could be reflective of mucosal immunity conferred by multiple vaccinations. The problem is that us readers cannot discern for ourselves which interpretation is the correct one given that the authors did not provide clear details on the demographic information for those outlier data points.

Also, bear in mind that since this study is intended to examine the XBB 1.5 booster’s effects on increasing nasal neutralizing antibodies it does not take into account whether the prior vaccines may have resulted in mucosal immunity that only then could not be boosted by further vaccination with vaccine encoding a different version of the spike protein.

This is one of the issues related to many studies examining different boosters where additional boosters encoding different spike sequences may not show more variability in neutralizing capacity for pseudoviruses of said variants. Although people have taken this to be an example of Original Antigenic Sin the more plausible explanation is that prior recall may be sufficient enough to neutralize new variants.

Funnily enough, Lasrado, et al.’s own results did appear to show statistically significantly greater nasal IgG antibody titers for the receptor-binding domain of the XBB 1.5 variant post-booster (boxed in black below) while IgA values appeared not to statistically significantly change (Figure 3C & D).

Remember that IgG antibodies are the most common subclass of immunoglobulins and is generally the subclass referred to when discussing adaptive immunity. IgA antibodies are also widely prevalent but are generally recognized for their abundance in mucosal linings of the body such as the respiratory, nasal, and gastrointestinal tract. Thus, if we were to consider the idea presented at the start of the article we should infer that IgA antibodies would be the one to most readily target and attempt to elevate in numbers as these antibodies would be more prevalent at the initial sites of infection.

In Declercq, et al.’s findings they noted a high level of neutralizing antibodies within the nose relative to baseline antibody measures. Bear in mind that “baseline” here refers to measures prior to receiving any COVID vaccines and prior to any infection.

IgG and IgA antibodies are not made distinct in this graph, and thus the antibody titers likely reflect neutralizing capacity of all of the subclasses together.

When separated out both IgG and IgA subclasses appeared to be elevated after COVID vaccination and booster:

Granted, many of the IgA values measured fell below the designated cutoff. Also, the increase in both IgA and IgG appeared to be more robust after primary vaccination relative to booster which didn’t appear to show a statistically significant change. Nonetheless, these findings would appear to contradict the findings from Lasrado, et al.

However, bear in mind that this increase in nasal IgG and IgA could be driven by infection. This idea could be argued based on the fact that the researchers noticed that some participants did not appear to produce mucosal anti-S1 IgA antibodies and questioned whether this would only occur through infection:

Given that we did not observe mucosal anti-S1 IgA in all participants, we questioned whether natural virus infection was required to prime vaccine-induced mucosal IgA. Whereas nasal anti-S1 IgG titers were not different between participants with and without evidence of natural infection (defined as seroconversion of anti-N IgG before vaccination), we did observe higher serum titers of anti-S1 IgA in those with prior SARS-CoV-2 infection (Fig. 3, E to H). Nasal anti-S1 IgA was detected upon vaccination in almost all anti-N IgG–positive participants, whereas this was not the case for all anti-N IgG–negative participants (Fig. 3, G to H). Yet, half of the latter group also displayed nasal anti-S1 IgA, suggesting that mRNA vaccination can induce mucosal IgA responses.

In essence, given that some participants with no evidence of anti-N IgG antibodies still showed evidence of anti-spike IgA the authors suggested that the nasal antibodies likely came from vaccination.

And yet, within their Discussion they mention that this may not be the case due to the fact that anti-N antibodies only serve as a proxy for infection. Individuals who become infected with SARS-COV2 may not necessarily seroconvert and produce anti-N antibodies:

We also observed mucosal virus-specific IgA in approximately half of the anti-N IgG–negative study participants. Yet, it cannot be ruled out that some of the anti-N IgG–negative individuals did experience SARS-CoV-2 infection, given that seroconversion to anti-N does not always occur after SARS-CoV-2 infection, especially not in vaccinated individuals (37). Moreover, we cannot exclude the possibility that this observation is due to reactivation of mucosal recall responses primed by infection with other coronaviruses.

Therefore, it cannot be determined that any nasal antibodies may be derived specifically from the vaccines.

Declercq, et al. went on to further conduct an animal study which provides additional insights. The results won’t be examined here, but in short when rodent models were repeatedly vaccinated there were noticeable antibody titers within the lungs as indicated by Bronchoscopy and Bronchoalveolar Lavage (BAL) sample collection. This method involves flushing the lungs with a saline solution and reuptaking the fluid, which would ideally take up any antibodies and immune cells within the lungs.

The general findings here were interesting- they seem to suggest that immune cells of the mucosa were not the source of the IgA and IgG antibodies found in the rodent models, leading to the conclusion that repeat vaccination may just result in circulating antibodies that can eventually make their way to the mucosa of rodents.

Again, this is just a mere summary and I encourage readers to view the study for themselves.

Key Takeaways

In summary, the two studies presented provide a tale of how heterogeneous science can be. Even in this instance where two teams have attempted to answer the same question they have reached different conclusions. In fact, conflicting evidence is how science operates, and it’s why care should be taken in understanding the differences between studies and why results may be unconcordant with one another.

Here, the two studies show clear evidence of different sample population with different vaccination rates, different modes of vaccination, as well as different vaccine histories.

Not only that, but the method of sample collection and the assays used differ, resulting in different quantification of antibodies.

That being said, the general findings here seem to point to something that should be considered alarming.

We need to discuss mucosal immunity

The whole narrative around COVID vaccines, and quite frankly for many of the vaccines we have for respiratory infections is to focus on intramuscular injections- this is what’s been done before and the way that it should always be done.

And yet, the immune system is far more complex than just antibodies=good and more antibodies=more gooder. Various cell types and their immune responses are extremely critical in gauging one’s actual immunity. There’s also the dynamics between innate and adaptive immunity that must be considered.

More importantly- as highlighted by these two studies- there is no “one” immune system of the body. The immune response in the arm or in the blood does not tell us the immune response in the nose, lungs, or other organs.

As suggested by Declercq, et al. in particular any antibodies found within the nasal mucosa may just be a product of circulating antibodies produced by constant vaccination, and consequently doesn’t reflect priming of the nasal immune environment to target SARS-COV2 directly.

By all accounts, this should be considered one of the biggest indictments of the entire vaccine campaign. It tells us that the method of vaccination could have been completely wrong as repeat vaccinations may not provide protection at the most critical entry points into the body, explaining why these vaccines neither prevent infection nor prevent transmission.

It also should raise serious questions regarding the amount of unneeded harms that these vaccines could have caused. Imagine how many serious adverse events may have been avoided if the route of administration was altered.

Tang, J. & Sun, J. summarizes the two studies in their focus article in the following way which raises criticisms regarding the lack of mucosal immunity conferred through vaccination-pay attention to how the paragraph ends (emphasis mine):

Declercq et al. demonstrated that circulating neutralizing antibodies induced by current intramuscular mRNA vaccines can be translocated to the respiratory mucosa. However, the efficacy of this transfer is likely limited and may not be sufficient to prevent reinfection. In particular, both studies demonstrate that there is a lack of mucosal antibodies, particularly IgA, being produced locally after mRNA boosters. In contrast, mucosal vaccine boosters have been shown to directly induce robust local antigen-specific B cell and plasma cell responses, potentially leading to more efficient antibody production locally compared with intramuscular vaccines in animal models (6, 8). In addition, mucosal boosters can elicit strong antigen-specific resident memory T cell responses (6), which are crucial for preventing viral dissemination and the development of severe disease, something that intramuscular vaccines may not achieve as efficiently. The totality of current evidence supports the development of mucosal vaccines, further reinforced by the findings of Lasrado et al. (4) and Declercq et al. (5). Such a mucosal immunization approach could patch the gaps in our current “leaky” vaccines and help achieve the ultimate goal of sterilizing immunity (Fig. 1D).

Why is it that years later, after millions upon millions of vaccines have been administered worldwide, with innumerable vaccine harms and mandate harms, are we now seeing a push for mucosal vaccines?

Why wasn’t this considered far before the vaccines came to market, and what good would these vaccines do at this point after so many people have likely been naturally infected and would already have robust innate immunity?

All of this should have been hammered out years ago. All of this should have been in consideration prior to forcing people to take these vaccines.

To think that the entire approach to the pandemic was wrong from the start, and it’s only now that we are able to freely discuss how wrong so much of it was.

It’s another example of the many failures in public health, and why more free discussion was needed right from the beginning.

If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Also, please note that annual memberships are $30 for those concerned about pricing.

Subscribe now

Share

Share

When it comes to COVID vaccine adverse events there has been much speculation but not much clear, concrete evidence. It doesn’t help that those within the medical establishment have failed to do their due diligence in researching why some people are experiencing the multitude of adverse events being reported, and this has led many people to have to formulate their own hypotheses.

With respect to the adenoviral-based vaccines in particular, there is even less research directed towards finding out why people experience relatively high rates of a phenomenon called vaccine-induced immune thrombocytopenia and thrombosis (or VITT) compared to other vaccines. And now that most of these vaccines have been removed from market research incentive has also likely halted for the most part.

The only prevailing hypotheses i.e. the only hypothesis that has been entertained has suggested that pockets of high negative charges on parts of the adenoviral surface may bind to the highly positive cytokine Platelet Factor 4 (PF4). This binding appears to allow for a change in the presentation of PF4 that makes it immunogenic and allows for binding of anti-PF4 antibodies. Continuous formation of adenovirus vaccine/PF4 complexes allow for more anti-PF4 antibodies to bind and thus leads to the paradoxical cascade of clotting sans any platelet formation.

This has been highlighted in a prior post:

The work was made more evident by the fact that both those who experienced VITT and those who take blood thinners such as heparin both appear to present with anti-PF4 antibodies, and in fact it’s the correlation between heparin-induced thrombocytopenia and the initial presentations of VITT that helped to form this prevailing hypothesis.

Unfortunately, the trail for further research into this mechanism went cold, much to the chagrin of those who experience VITT and those who are trying to seek out answers.

Now, for anyone with a sense of intuition, and hopefully something I highlighted previously, one would see such a hypothesis and believe that the best course of research would be to look into adenoviruses and see whether infections themselves are known to produce anti-PF4 antibodies. Obviously, if such an event were present in the literature then we would have a trail that could provide further insights into drawing a direct relationship between the adenoviral vector itself and the cause of VITT.

Unfortunately, I couldn’t find anything regarding anti-PF4 antibodies and adenoviral infections, meaning that there has been a huge gap in the literature even though this would be an avenue worth researching. And even with the first instances of VITT there is no clear endeavors to look into this association. Again, it seems like it would be an obvious thing to look into given that VITT are somehow more prevalent among adenoviral-vaccine recipients and it is one of the main differences in vaccine formulation relative to the other things on the market.

And yet it would take just until last week for a very small editorial to suggest this exact thing- that anti-PF4 antibodies produced by those with VITT share remarkable similarity to people who experience anti-PF4 antibodies following an adenoviral infection.1

Again, this work is very small and focuses on very few participants. Nonetheless, the researchers took to looking into something that not many people have looked into.

That is, what antibodies are people producing that are anti-PF4 antibodies?

For a while we have discussed how critical antibodies are to fighting off infections. Although the entirety of the immune system should be evaluated antibodies do work as one critical component of our adaptive immune system.

However, what many people may not know is that the antibodies we produce aren’t all similar to one another. That is, even though two people may produce antibodies to help fight against SARS-COV2 it doesn’t mean that these same two people are producing the same antibodies as one another.

This has been overlooked quite often in immunology research, and funnily enough something that I have mentioned before as an issue with discussions on immunology since the type of antibodies (or really the sequence on the heavy and light chains) people produce are likely to greatly vary from person to person.

Thus, it’s not the number of antibodies but the type of antibodies that provide better context.

Here, the researchers took to examining the antibody makeup of a few people who have VITT, and noted that all of the participants carried the same allele for a heavy-arm chain sequence:

All the patients with VITT who have been evaluated have expression of the IGLV3-21*02 allele and a heavy-chain motif, resulting in at least eight acidic (negatively charged) amino acids of the paratope (antigen-binding region), by which anti-PF4 antibodies bind to their antigen. These negatively charged regions mediate strong binding of the antibodies to the positively charged arginine and lysine residues on PF4.⁵

Remember that PF4 is argued to be highly positive, and this explains why PF4 may bind to both heparin and highly negative regions on the adenovirus vector. Therefore, it wouldn’t be surprising that an antibody bearing a highly negatively-charged paratope would also bind with PF4 well- this is a clear case of opposites attracting.

Here, the negatively charged amino acid sequences are shown in red, which also includes a mutation in one portion of the light-chain from a positively charged lysine into negatively charged glutamate and aspartate:

In Figure 1B a representative sequence of someone with VITT is shown at the top. The sequence of 4 people who were previously infected with an adenovirus and positive for anti-PF4 antibodies are shown below that sequence.2 In all those instances note that the amino acid in those 8 positions are homologous, suggesting that the antibodies produced in response to adenoviral-based vaccines and to adenoviral infections themselves may be the same.

The authors put these findings in the following way:

We conclude that the antibodies induced by adenoviral vector–based Covid-19 vaccination (classic VITT) and the VITT-like antibodies induced by natural adenovirus infection are extremely similar. Such an extraordinary level of autoantibody fingerprint identity between two disorders — at the level of patient-derived antibodies — strongly indicates that VITT and the anti-PF4 disorder that is associated with adenoviral infection are a distinct class of adverse immune responses associated with viral (presumably, adenoviral) structures.

Our findings indicate that the anti-PF4 disorder that was first recognized as VITT is essentially identical to the disorder caused by adenovirus infection that occurs sporadically. Thus, the clinical lessons learned from VITT remain relevant: thrombosis associated with thrombocytopenia with greatly elevated d-dimer levels — particularly after a viral infection — may be investigated and treated as an anti-PF4 disorder.

Be aware that this work is rather preliminary- more participants and greater assessment of both VITT patients as well as patients who experience anti-PF4 antibodies post-adenovirus infection is needed to better establish this link.

Nonetheless, this is the closest that we have gotten to finding an actual causal link between VITT and the vaccines, and the answer lied in none other than examining those who were infected with adenoviruses- the exact place where people should look in order to make proper comparisons!

So although this editorial provides additional insights into VITT it’s also frustrating that it took this long to do something that should have been so obvious to any researcher! How many people thought to look into those who had adenoviral infections to see if they produced anti-PF4 antibodies? Why is the literature scant with this possible autoimmune disease? And how many blood clotting disorders have gone unrecognized for possibly being anti-PF4 in nature and stemming from viral infections?

All of this highlights obvious pitfalls in research where something that should be rather easy to intuit took so long to finally be researched. It probably helps to explain why research is in such a sad state as it is when things that should seem obvious don’t appear obvious to many people.

If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

2

Patient information from the Supplementary Appendix can be seen below. Note again that these patients showed very low platelet counts but were also positive for anti-PF4 antibodies:

Share

By now you’ve likely heard that pharmaceutical giant AstraZeneca, maker of the adenoviral-based COVID vaccines predominately available within European countries, has halted marketing of these vaccines appearing to cite “low demand”.

At least, this is the proposed reason as reported by CNN:

But the vaccine has not generated revenue for AstraZeneca since April 2023, the company said.

“As multiple, variant Covid-19 vaccines have … been developed, there is a surplus of available updated vaccines. This has led to a decline in demand for Vaxzevria, which is no longer being manufactured or supplied,” it said in a statement shared with CNN Wednesday.

“AstraZeneca has therefore taken the decision to initiate withdrawal of the marketing authorizations for Vaxzevria within Europe,” it added.

Several outlets have cited this reason as well, although their text doesn’t point to any definitive claim that the vaccines being removed due to low demand.

It’s also timely that this would occur after class action lawsuits have been brought forth regarding alleged harms caused by AstraZeneca’s vaccines, with AstraZeneca admitting that thrombosis with thrombocytopenia syndrome (TTS) is very rare but possible with their vaccines.

This admittance doesn’t quite amount to much given that there has been robust evidence noting an apparent signal of TTS in those who are provided adenoviral-based vaccines. So although a formality it reiterates something that has been well-known by many, and is also one of the reasons for early criticisms of these vaccines.

Nonetheless, this removal of AstraZeneca’s vaccine may seem like a move in the right direction. However, I hesitate to make such a statement due to one concern that I have raised with the removal of J&J’s EUA, and that is that the removal of these vaccines may remove any incentive to research adverse events related to these vaccines.

No more manufacturing means no more vials of vaccines for researchers to examine or experiment with to examine for adverse events. This is something that was a concern a while back when many vials of mRNA vaccines were being destroyed due to low demand instead of being provided to researchers:

Again, what this means is that unavailability of these vaccines works both for the public while against research endeavors. It doesn’t help that research into adverse events related to the adenoviral vaccines was already behind relative to the mRNA vaccines, likely due to the lower number of people receiving these vaccines as well as J&J’s EUA removal. Bear in mind that the controversies surrounding these vaccines likely influenced their reduced uptake anyways in favor of the mRNA platform.

This is partially reflected in the recent document released from the National Academies Press where it was noted that the removal of J&J’s EUA and the limited availability is reflected in the limited studies available regarding this vaccine in particular:

As of now there is still no clear mechanistic explanation as to why TTS is occurring in some vaccinees. The predominate hypothesis available suggests that complex formation between the adenovirus and and platelet factor 4 may expose immunogenic regions in the complex which can cause an immune response, with clot formation being the end result of this immune response:

Unfortunately, this hypothesis is the prevailing hypothesis not because the evidence available is robust, but because it is one of the only hypotheses that has been researched. And even then there hasn’t been much headway in validating this Adenoviral/PF4 complex formation.

So as it stands there really isn’t much information explaining how TTS or even Guillain-Barre may be caused by these vaccines.

And with such a gap in information the removal of these vaccines may work to hamper any research even further.

We’ll have to see if this proves to be true, but it doesn’t help that there is limited research regardless.

Anyways, just a hesitant word of caution.

If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Share

A recent, nearly over 300 page document has been published in the National Academies Press, a journal dedicated to publishing work from the National Academies of Sciences, Engineering, and Medicine.

Although the institutions receive funding from the government and were established by Congress they are argued to be independent operators with large influence regarding many policies within the sciences and medicine.

All this to say it’s rather surprising to see such a committee releasing such a dense document with arguments suggesting an association between COVID vaccines and some adverse events.

The committee was put together by The Health Resources and Services Administration (HRSA) in order to review potential harms, and was comprised of various people from different fields to evaluate the available evidence.

The committee reviewed the available evidence for all vaccine platforms. However, given the limited literature available for some platforms such as the adenoviral vaccines, as well as the relatively recent approval of some vaccines such as Novavax’s vaccine, the review had evidence predominately examining adverse events related to the mRNA vaccine platforms.

When looking at a total of 85 possible adverse events the committee argued there to be sufficient evidence to draw conclusions for 20 of these adverse events. Note that conclusions may argue in favor or in rejection of a link between an adverse event and a vaccine platform.

Conclusions of causal links were separated into the following categories. Pay attention to some of the language here:

“Further research is unlikely to lead to a different conclusion.”

That is, in cases where the committee argues that the available evidence establishes a causal link between vaccine platform and injury then it’s not likely that further evidence will come to refute this link.

In summary, the committee concluded that there is enough evidence to establish a causal link between the mRNA vaccines and myocarditis. In addition, the committee also concluded that there is sufficient evidence to accept a causal relationship between the adenoviral vaccines and thrombosis with thrombocytopenia syndrome (TTS) as well as Guillain–Barré Syndrome.

Again, this would mean that further research regarding the link between the mRNA vaccines and myocarditis are not likely to refute these conclusions- well, that will likely depend on how much weight and influence the committee’s conclusions make within a wider context.

I haven’t looked at the document in full and so any interpretation of the document comes from a cursory glance.

The summary of the committee’s evidence is as follows, which appears to include evidence that has been mentioned by other vaccine skeptics already as possible mechanisms of harm:

Note the comments made at the end which also emphasize that certain platforms may favor different adverse events, and likely may be related to differences in vaccine components.

But there are also a few additional things worth considering.

For instance, the committee makes a comment that the limited information regarding the adenoviral vaccines may be tied to their approvals being revoked.

This is something I commented about in which I argued that the revoking of the EUA serves as a double-edged sword. Although this may mean fewer COVID vaccine products available to the public, it also means fewer vaccine products available for research and incentive for investigation into adverse events.

So one has to contest with the fact that the limited data on adenoviral vaccines may be due to the lack of availability of the adenoviral vaccines vaccines, and therefore possible links between these vaccine platforms and adverse events may be missed.

And there’s also something that evokes even further questioning. The committee also looked into shoulder injuries related to the vaccines, but instead of citing the typical pain and soreness the committee examined other injuries.

Here, the conclusions are rather shocking:

Note that both bone and nerve injury are included above, and also clarifies possible injury from direct injection into bone and nerve.

Now, remember that prior discourse regarding vaccine adverse events have included possible injection of vaccines into blood vessels, with circulation of vaccines being a possible reason for some of the harms seen. However, not much talk has come about regarding possible injection into bone and nerves, which themselves may be responsible for a variety of adverse events as well.

Thus, such conclusions by the committee pose even more questions to the extent that it may not be vaccine platform that may explain some adverse events, but that improper injection site may also be responsible for some adverse events. Again, I haven’t reviewed the document so I can’t make any opinion regarding the evidence used to support establishing the causal relationship between vaccination and bone/nerve injury.

Nonetheless, this possible scenario has crossed my mind during the first period of vaccine rollouts. Consider a person whose sole job is to administer vaccines all day, who may also need to operate as a vaccinator for days or weeks on end. Although most vaccines may be intramuscular there may be the off chance that some may be intravenous or may even be administered into the bone or nerves of a vaccinee, and this risk may increase with fatigue and redundancy of tasks. There’s also a question regarding how well some people may be trained as well as other variables.

All to say that it’s quite possible that some of these adverse events may not be related to the vaccine itself but possibly due to iatrogenic-related events, and may be an important variable that has been overlooked.

With the release of this report there’s no doubt more writers will pick apart its content. This serves more as a superficial glance into some of what was investigated, and hopefully more clarity will provide more things worthy of investigation.

If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Share

Well, if you thought one COVID shot would be considered crazy what would you think about 217?

In a case report published by The Lancet1 on Monday researchers highlight a strange case in which a 62-year old man from Magdeburg, Germany (named HIM) has come under investigation for allegedly obtaining 217 vaccines within a 29-month time span.

Hypervaccinated seems like a gross understatement here! The story seems rather complex, but the case report seems to suggest that a case was being constructed by prosecutors, who may have caught wind of all of these vaccination events:

HIM's hypervaccination occurred outside of a clinical study context and against national vaccination recommendations. Evidence for 130 vaccinations in a 9 month period was collected by the public prosecutor of Magdeburg, Germany, who opened an investigation of this case with the allegation of fraud, but criminal charges were not filed. 108 vaccinations are individually recorded and partly overlap with the total of 130 prosecutor-confirmed vaccinations (appendix 2 p 12).

It’s worth noting that the details of the actual number of vaccination is murky, likely due to lack of clear corroborating evidence (at least at this time). The authors provide a spreadsheet with up to 130 suspected vaccination claims, with only 26 being documented as being “confirmed”. The rest of the claims are either “recorded” or left blank regarding vaccine documentation, so take the actual number of vaccinations with a grain of salt for the time being.

Even more alarming is that the man allegedly got multiple vaccines of different platforms in the same day! Again, the whole situation seems extremely absurd, and hopefully some more information comes to light for this scenario.

Fortunately, or maybe unfortunately, researchers considered this a good learning opportunity, and thus wanted to examine the immune response of HIM:

To investigate the immunological consequences of hypervaccination in this unique situation, we submitted an analysis proposal to HIM via the public prosecutor. HIM then actively and voluntarily consented to provide medical information and donate blood and saliva.

There are a few additional points to raise.

• Note that HIM appears to have gotten all of these vaccines for personal reasons. It seems that people are looking into these reasons right now, but that’s not much of a concern for me.

• The case report doesn’t make mention of any adverse events related to the vaccines. Given the high degree of subjectivity in this report it’d be difficult to dismiss this possibility, especially if this individual was so eager to get this many vaccine to begin with. That is, I wouldn’t be surprised if HIM downplayed any adverse events if it may make it less likely that he could get future jabs. Again, a ton of subjectivity is at play here.

• Strangely, even with all of these jabs HIM doesn’t appear to have any prior evidence of a SARS-COV2 infection, at least when tested using PCR and serology tests. Of course, one may assume that an individual so ready to receive this many vaccines may take other precautions to avoid COVID altogether. The case report doesn’t make mention of this individual’s behavior, o we’re left in the dark regarding that as well.

• HIM seems to have gotten predominately Pfizer and Moderna’s mRNA vaccines. However, the initial vaccines were of the adenoviral platforms. Thus, aside from one protein-unit vaccine booster (from Sanofi/GSK), as well as the first few adenoviral platforms, nearly all of the reported vaccines are of the mRNA platforms.

But what appears to be one of the strangest, and possibly unethical situations, is that HIM appears to have gone on to get 4 additional vaccine even after being included in the study:

This at least explains why immunological profiles were constructed for HIM in between the alleged 213th and 217th doses.

In order to compare HIM’s profile researchers used a reference group of 29 vaccinees who received 3-doses of mRNA vaccines.

So, given all of these alleged vaccines was there anything completely abnormal with HIM’s profile?

Strangely, it doesn’t seem as if HIM’s profile was all-too different from 3-dose vaccinees. As is reported in many studies anti-spike antibodies tend to increase in the time immediately following vaccination, eventually tapering off over time.

The only distinction appears to be the fact that HIM appears to be producing more antibodies in general relative to vaccinees, and appears to be related to the higher neutralization capacity of HIM antibodies against both Wildtype and Omicron relative to vaccinees’ neutralizing capacity:

This seem to be reflected in the fact that HIM appears to have a higher number of CD8+ effector memory and effector T cells, as well as spike-specific B-cells. T cells also appear to show higher clonal expansion, but once again the differences between HIM and vaccinees don’t appear to be egregiously different (at least based on surface review).

Now what may interest readers is the idea of IgG4 conversion. If any person would show a clear indication of IgG4 conversion it may be an individual who has allegedly received hundreds of vaccines.

Again, this seems to be case of quantity, such that HIM appears to produce a higher number of IgG4 antibodies relative to 3-dose vaccinees. However, this is likely reflective of the fact that HIM is producing far more anti-spike antibodies in general.

This is reflected in the comparison between Figure S1 B and C:

Therefore, although it appears that HIM is producing 2.9x more IgG4 antibodies compared to vaccinees, HIM also appears to be producing a lower proportion of IgG4 relative to the total IgG pool quantified, with HIM appearing to have a 4.39% anti-spike IgG4 antibody pool as compared to controls who show around a 12.38% anti-spike IgG4 pool relative to their total IgG pool.

So even with far more vaccines HIM doesn’t appear to show extensive IgG4 conversion. It’s important to consider that, once again, this case is extremely subjective- we don’t know the extent of this person’s actual vaccine history or what his personal medical history entails.

That being said, one possible explanation for this lack of IgG4 conversion would be that HIM’s initial vaccinations with the adenoviral vectors may have buffered any IgG4 conversion down the line. Growing evidence suggests that those who took the adenoviral vaccines as their initial vaccines don’t appear to show the same degree of IgG4 conversion as mRNA vaccinees, even after heterologous vaccination with the mRNA platforms.

This creates a very interesting route for speculation. Barring other confounders and variables, the case of HIM helps to raise the following questions:

• Is there a jumping off point in IgG4 conversion, in which case IgG4 conversion may taper off after repeat spike exposure?

  • This one seems more speculative.

• Does the initial presentation of spike dictate the direction that IgG4 conversion will take? That is, in those who are not presented with spike through mRNA will the IgG4 conversion be buffeted regardless of how many spike events occur, and the manner in which it is presented?

  • The current evidence already seems to point in this direction, but HIM’s case appears to provide an extreme case of IgG4 conversion being hindered, possibly with initial adenoviral vaccine administration. Maybe an original vaccination sin is in order? (I kid!)

So outside of the absurdity presented by this case it at least provides some avenues to consider when it comes to too much vaccination. Of course, we should keep in mind that this case is a super special one with a ton of subjectivity and uncertainty.

Hopefully researchers can continue to poke and prod HIM for future insights immunological-wise- he’s already shown that he has no problems serving as a guinea pig anyways!

If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

Edit: Grammatical correction was made below (Not was added to the beginning of the malfeasance sentence). Thanks to nobler for pointing that out!

Last week a study was published in the journal Vaccine1 examining adverse events associated with COVID vaccines, taking a look from a global perspective.

The timing seems to coincide with the widespread reports of Good Ol’ Joe’s escapades in being “cognitively unfit”, possibly drawing attention away from this study- just a random thought I had and not pointing to any conspiracy.

This study is the largest of its kind, encapsulating almost 100 million individuals, over 180 million vaccination events, and spans over 8 countries included in the Global COVID Vaccine Safety (GCoVS) Project, which is part of the Global Vaccine Data Network™ put in place by the CDC to monitory vaccine safety data from across the world.

The countries included in this study include:

• Argentina

• Australia

  • New South Wales

  • Victoria

• Canada

  • British Columbia

  • Ontario

• Denmark

• Finland

• France

• New Zealand

• Scotland

Surprisingly, America is not included even though this seems to be part of an initiative put forth by the CDC.

The study period spans from December 2020 up until August 2023. Bear in mind that data collection was not consistent among the included countries, with some countries only comprising a little less than a year of data as in the case of New South Wales, Australia. Argentina seems to have the longest data collecting time period of 32 months, and likely serves as the time frame mentioned between 2020 and 2023.

Also, note that data collection was heterogeneous, with patient type recorded being different across countries where some may have calculated solely on inpatient hospitalization while others may have included both emergency visits and inpatients.

Take note of some of these differences in reporting from a portion of Supplementary Table 1:

Breakdown between sex, age, and dosage across the countries can be noted in Table 1 (if difficult to read look at the table through the study- note that there seems to be a misprint in the Table as Moderna’s vaccine is shown twice and ChAdOX1 is missing):

Surveillance data was limited to within the first 42 days after receiving a dose, with the risk breakdown being separated by the following time periods:

• 0-7 days

• 8-21 days

• 22-42 days

• 0-42 days

Like with other studies Day 0 refers to the date of vaccination.

The adverse events that were examined were limited to a list of Adverse Events of Special Interest (AESI), so keep in mind that not all adverse events were examined and therefore some information is being missed with this dataset. The list of AESI can be seen below from Supplementary Table 2:

Odds ratio of adverse events were calculated based on pre-COVID vaccine data, serving as a baseline for expected event rates:

For each site, we calculated the observed number of events for each AESI in the risk interval after introduction of COVID-19 vaccination. To calculate the expected number of cases, we used pre-COVID-19 vaccination background rates data from 2015 to 2019 (2019–2020 for Denmark) collected in the GCoVS Background Rates of AESI Following COVID-19 vaccination study [13]. The observed follow-up period in person-years for a given vaccination profile and post-vaccination period was stratified according to age group and sex. Each of the age-sex stratified person-years were multiplied by the corresponding age-sex stratified background rate. This resulted in the expected number of cases in each stratum, which were then summed to give the total number of expected cases during the observed follow-up period.

In summary, when the data was examined there was a statistically significant safety signal regarding the adenoviral-vector vaccines and GBS rates, as well as CVST. Note that the following colors notes statistical significance, with yellow and red noting statistically significant odds ratios regarding adverse events and the COVID vaccines listed.

And when it comes to cardiovascular issues note that all 3 vaccines were noted to have statistically significant odds ratios, with the mRNA vaccines showing statistically significant safety signals:

There are some interesting things to point out here. Note that neurological and hematological AESI are noted predominately with the 1 dose. There are several factors to consider here, as adverse events may make people less inclined to get further doses and therefore may select for a bias in favor of the perception that further doses appear safer. It’s important to keep in mind that the population demographics in question are likely changing between doses.

However, what’s interesting is that cardiovascular-related AESI are increased across all doses, and thus raises a question about the differences in how adverse events are manifesting. The argument over adverse event dropouts wouldn’t explain why people may experience cardiovascular-related AESI at dose 3 or 4. One possible explanation may be the heterogeneity of symptom onset, where people who may have unnoticed cardiovascular damage after the first or second dose may experience symptoms after receiving boosters, leading to late dropout from repeat vaccination.

Bear in mind that the adenoviral-based vaccine ChAdOX1 shows a very high odds ratio of near 7 for pericarditis during dose 3. One question I would ask is whether this may be a shuffling effect where people who may have gotten an adverse event from the mRNA vaccines may have been persuaded to go with a different vaccine platform rather than foregoing them entirely. There may be a bias to the extent that people who would have dropped out from mRNA boosters may be shuffled into the ChadOX1 group leading to the very high safety signal noted. The population receiving the ChAdOX1 booster are likely to be far lower as well, meaning that any noted AESI may bias higher.

For those interested take a closer look at the study itself as this is intended to be a quick view.

What’s important is that this study corroborate many of the anecdotes and studies that have been in circulation for years, only this study helps to emphasize the concerns over these vaccines on a global scale. It raises questions regarding the extent of possible adverse events being seen worldwide, and emphasizes the need for greater surveillance and more diligence in providing answers to how damaging these vaccines could be.

It also raises questions over why certain AESI manifest at different dosages.

Bear in mind that even with such a large population study there are still so many things that are left unanswered, including the susceptibility of certain demographics (i.e. do certain adverse events manifest more commonly among certain demographics), as well as the number of other adverse events that were not included in this study.

And what’s likely to be more important is understanding what all of this may mean in the end.

To that point, the authors end their study with the following disclaimer, making a point to note that the results of this study don’t reflect the views of the CDC:

All analyses, inferences drawn, opinions, conclusions, and statements are those of the authors and do not necessarily represent the official views of, nor an endorsement by, CDC/HHS, or the U.S. Government. For more information, please visit cdc.gov.

Parts of this material are based on data and/or information compiled and provided by the Canadian Institute for Health Information and the Ontario Ministry of Health. The analyses, conclusions, opinions, and statements expressed herein are solely those of the authors and do not reflect those of the funding or data sources; no endorsement is intended or should be inferred. Parts of this material are based data and/or information provided by the British Columbia Ministry of Health. All inferences, opinions, and conclusions drawn in this manuscript are those of the authors, and do not reflect the opinions or policies of the Data Steward(s).

But then what exactly is the stance of the CDC, and to what degree of seriousness are they taking the VAERS reports and anecdotes that continue to come out? What does it mean when a study based on data provided to the CDC runs counter to the narrative the CDC itself puts out regarding these vaccines?

The CDC needs to address these findings. Not doing so would be considered malfeasance and an act of neglect. The fact that mainstream outlets such as Bloomberg is covering this study points out that this isn’t something that the CDC can just obfuscate.

If anything, studies such as these help to put the CDC in the spotlight of accountability.

If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

Correction: As Brian Mowrey mentioned in the comments in my previous article note that the reference to the cells in this study are “leukocytes”. This is likely due to the cells that are being sourced, as blood samples were taken from patients. Note that my explanation is simplistic as it doesn’t take into account that the results are specific to leukocytes, as in we can’t infer what is happening in other cells. It also has to take into account whether the sample leukocytes are representative of all of the patients’ leukocytes as well. Because of these factors it isn’t correct to try and compare the allegedly found spike protein to the Sanger sequencing because there may be full, correct integration in other cells that were not sourced, but again remember that the study did not look for these alleged cells, and so we are still left with the answer of “we don’t know”.

This correction should provide some context to #1 as it’s not an accurate rebuttal to the study since both can exist without contradiction one another- it may mean that the cells being sourced may not be the correct ones. Granted, it may also mean that integration isn’t happening at all. It requires that the authors provide clear evidence in support of their assumption.

This also still leaves the issue that the sequence is super messy, to the extent that it’s hard to argue that this is any validation of integration. Again, there are several issues with the sequence alignment that poses many questions.

Consider this a follow-up to yesterday’s post. Hopefully this will clear up some things that may have been confusing from yesterday’s post. I’ll blame any confusion portions of my article yesterday on me falling ill post-Christmas. What a gift that is!

Here is the post in question for those interested:

1. Findings that contradict one another

Yesterday I raised questions regarding the mass spec results. Here, the authors took serum from patients and treated them to trypsin to digest the proteins. The authors allege that the mass spec results could find distinct patterns between virus spike and vaccine spike, looking in particular at peaks for 830.3 and 979.4 m/z in particular.

I don’t know why these peaks were used in particular, but let’s assume that these peaks were the result of previous studies looking at vaccine spike and their fragmentation patterns when treated with trypsin.

If true, then these findings may suggest constantly circulating spike, but the authors don’t provide us any reasons to believe that we can reach this same conclusion as them.

What’s made worse is that their sequencing results would actually contradict these findings.

Now, let it be clear that these results are not what the researchers are making them out to be- I don’t trust that the alignment is accurate and I explained why in the prior post (and will further elaborate in this post) but again let’s assume that the amplicon sequence is accurate:

Even if we are to trust the amplicon sequence (the bottom sequence in (B)), then we can clearly see there are parts in which the bases from the amplicon don’t match the bases from the Pfizer sequence.

This may seem like nothing important, but remember that DNA → mRNA → Proteins. That is, any places where there are mismatches in the amplicon sequence relative to the reference Pfizer sequence, we have to speculate that this may code for a different amino acid, and if so then the molecular weight of the spike protein would be different. This would be even more so if the base changes would remove any lysine or arginine residues in the protein since those are trypsin digestion sites.

All this to say that we can’t accept both experiments as being accurate because both would contradict one another. If the mass spec results are reliable then that would infer that the integrated sequence is a 100% to the Pfizer sequence, otherwise you would be making a different protein with different fragmentation patterns. But if the Sanger sequence is accurate then it tells us that we must accept the base mismatches between the Pfizer sequence and the amplicon sequence, which again would suggest that the mass spec results may not be trusted.

Both results cannot be accepted because both results would contradict one another.

Of course, a rebuttal to this may be that the mass spec results are qualitative. The authors appear to be looking at percentage of each m/z peak, but again without further clarification we as readers can’t speculate on how to interpret the data. It should be made clear by the researchers.

2. Those are funny looking bases

Now, there’s one thing I didn’t clarify in yesterday’s both that’s worth considering as a critique for the findings.

Aside from the typical G,A,T, and C bases one would see in sequencing you may have noticed a few other letters such as M, Y, V, S, and R (among a few), as boxed below:

These additional letter notations are referred to as “degenerate bases”, and usually refers to areas where several different bases may be “called” rather than one distinct base.

The nomenclature used by IUPAC is as follows (from Wikipedia):

Now, in some of the articles I’ve seen they’ve commented that the two-base degenerate calls are a sign of messy sequencing product. However, there’s also a very clear explanation for that sequence as well, and that answer lies within our genomes.

That is, as a species we are diploid- we carry two sets of chromosomes rather than one or 3 as in some plant species. Because we are diploid we can exhibit heterozygosity, where a gene on one chromosome may code for a different genotype/phenotype as a similar gene on the other pair of the chromosome, usually stemming from different mutations within said gene.

These base differences in genes are called polymorphic regions, and can be elucidated by sequencing.

In this case, it’s not likely that those degenerate base calls are due to messiness, but are likely a sign that the sequence that was amplified- whatever it is- is polymorphic. Or put another way, the person who this sequence is taken from is likely heterozygous for whatever this sequence is.

For example, HLA, some of the most polymorphic genes we have, tend to show a lot of heterozygosity within the population. An example chromatogram, albeit a bit old, can be seen below where a “Y” and “K” are shown to indicate someone who is heterozygous for HLA-C alleles1:

Of course, poor sequencing should be considered but for anyone who has done sequencing of human genes polymorphism are a given for these samples.

This actually raises even more critiques towards the idea that this is evidence of integration, because again remember that integration would require that an entire sequence (in this case over a 4,000 bp insertion) be integrated into the person’s genome. This is where the nebulous statement of integration ends up biting vaccine skeptics in the rear end, because without any clear context it becomes easy to suggest that anything can be an example of integration.

To me, what this sequence appears to suggest is not integration but likely that some polymorphic sequence was amplified.

Again, the authors could add further clarification for their sequence results, but the fact that heterozygosity is shown suggests that this isn’t a vaccine sequence that may have been amplified. Keep in mind that the primers the authors used appear to be nonspecific, and so it’s likely other genes may have been selected for and them amplified. This is why the lack of using additional primers for nested PCR is a problem- it removes much-needed filtering of off-products.

3. You shouldn’t be able to see this sequence.

As mentioned yesterday, further evidence that this alignment is incorrect is the fact that the allegedly homologous sequences like outside the amplified region. Remember that the “AGCAATT” sequence is found upstream of the amplified region, and therefore should not have been amplified through PCR. Put another way, there’s no way the authors would be able to see this sequence because it shouldn’t appear within their amplicon. This adds further evidence that they may not have amplified the end sequence of the vaccine as they assumed, and again likely amplified some native sequence within the patient.

It’s rather surprising that not many people who have reported on this paper have caught this discrepancy. The authors are expecting us to looking at an alignment that should not exist- the “AGCAATT” sequence should not exist because it’s not part of the region bound by the primers used!

And to add further evidence of this impossibility note the numbers above the sequences:

These numbers tell you the position of the bases being looked at. This adds further evidence that, for some reason, the authors aligned their amplicon with the beginning of the Pfizer vaccine sequence. We can verify this by looking at the sequence from github.

Note that every row is around 90 bp each. If we use the “AGCAATT” sequence as a reference sequence to look for we can see there is around 12 rows of bases, or around 1080 bases until you reach the correct row for the “AGCAATT” sequence:

Again, this adds further emphasize that the authors aligned their amplicon sequence not with the proper region of the Pfizer vaccine (i.e. the end) but rather aligned their amplicon with the beginning sequence of the vaccine. Remember- this shouldn’t be possible because this portion was not amplified by PCR!

I’m not sure why this may have happened. One possibility could be that the authors told the software to align wherever possible and they didn’t catch that the alignment was somewhere it shouldn’t be. There are other reasons that may be more cynical, but I won’t delve into that.

All this does is suggest that the authors didn’t find a sequence that they allege they did, and all the work around it obfuscates the fact that these are not matching sequences and is a clear indication that they did not confirm vaccine integration.

This further emphasizes that this study doesn’t prove much of anything, and yet I’ve seen several articles doubling down on these findings. Why is it that confirmation bias overlooks bad science? Shouldn’t it be clear that there’s something fishy with this study, so why is it that vaccine skeptics are still holding it up as a bombshell study?

So for a tl;dr:

• The mass spec and Sanger sequence results are self-contradictory. Both can’t be simultaneously correct.

• It’s very likely that the author’s did not amplify the Pfizer sequence, mostly because there lacks clear homology between the sequences. The heterozygous nature of the patient’s amplicon adds further suggestion that some native sequence was amplified.

• The author’s own alignments shouldn’t be possible because their alignments fall outside of the region that they allegedly amplified. Several bits of evidence suggest that the alignment is incorrect including where the “AGCAATT” sequence is found and the base numbers which suggest once again that the alignment was done upstream of the amplified region. All of this warrants serious scrutiny of this study.

• As Brian Mowrey mentioned in the comments yesterday you shouldn’t have gaps in the reference sequence. After all, you are referring your sequence to that original reference sequence. One area you may notice gaps is alignment of SARS-COV2’s spike with the spike of other coronaviruses due to the existence of the furin cleavage site, where in this case a gap for other coronavirus sequences are used to keep the rest of the sequence in alignment. An example can be seen below2, although note that this example is looking at amino acid sequence and not nucleotide sequence (the concept is the same). Note that this is intended to infer insertions/deletions of bases, which shouldn’t be the case for a reference sequence. This adds further scrutiny as to why these gaps in the reference sequence even exist.

If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Please if readers have any questions comment below as I understand if this article is rather confusing.

Correction 12.27.23: As Brian Mowrey mentioned in the comments note that the reference to the cells in this study are “leukocytes”. This is likely due to the cells that are being sourced, as blood samples were taken from patients. Note that my explanation is simplistic as it doesn’t take into account that the results are specific to leukocytes, as in we can’t infer what is happening in other cells. It also has to take into account whether the sample leukocytes are representative of all of the patients’ leukocytes as well. Because of these factors it isn’t correct to try and compare the allegedly found spike protein to the Sanger sequencing because there may be full, correct integration in other cells that were not sourced, but again remember that the study did not look for these alleged cells, and so we are still left with the answer of “we don’t know”.

This still leaves the issue that the sequence is super messy, to the extent that it’s hard to argue that this is any validation of integration. Again, there are several issues with the sequence alignment that poses many questions.

Subscribe now

Share

Since the start of this Substack it was my intent to examine many manners of COVID vaccines, COVID, and other topics related to health in science given that I have some background in the field.

However, while going down this rabbit hole what became extremely apparent was that even having a background in science isn’t enough to understand the vast wealth of knowledge and information available. It made me realize how ignorant and unprepared I was even carrying a degree in biochemistry and having worked in a lab for several years.

So part of this Substack wasn’t intended just to disseminate information to readers, but also served as a way to learn more about available science, and in particular become more adept at parsing studies and seeing whether studies are of merit, of some studies utilized flawed methodology, or if researchers may just erroneously make conclusions that are not supported by their own research.

It became part of my intent to educate readers so that they can parse information themselves- know how to break down what they are reading rather than being told what to think of a study. But again, such work requires plenty of time and effort, especially if it requires one to gain a ton of background knowledge in order to better break down a study.

Unfortunately, over the past few years I began to question how may vaccine skeptical people are engaging with evidence in the same manner- scrutinizing bad data and understanding what it is they are looking at when presented with a figure. Rather, it appears that confirmation bias can plague even vaccine skeptics; an issue that many groups may succumb to regardless of their stance.

If something appears to suggest some issue regarding the vaccines it may be picked up and used as a talking point even if the evidence isn’t there to support such a conclusion.

This brings us to the current predicament with this study1:

A lot of people have covered this study recently, using it as bombshell evidence that mRNA vaccine integration is occurring. Again, the question we need to wrestle with is not confirming the study for the sake of our own biases, but to see if the study is actually of merit.

As a foreword for readers, this study has plenty of issues, and honestly raises serious questions as to what exactly the authors were doing.

To start, the study looked at 81 people who are alleged to be Long COVID patients to determine where their Long COVID symptoms may be stemming from- either virus or spike derived or vaccine spike derived.

This is, right from the start, a problem as there is no explanation for what criteria were used to suggest that these patients were Long COVID patients. Because this study is looking at both vaccine and virus spike it’s also important to differentiate and categorize patients based on time of symptom onset and time from infection/vaccination, which again is not described.

Note that for the 70 patients where clinical data was known all 70 were previously infected whereas 51 (~73%) of patients were vaccinated:

This creates a problem because there’s no clear differentiation between vaccine or virus spike- it relies on the authors to look for something and to make an assumption about what they have found, essentially leading to a fishing expedition.

To that, the authors utilized mass spectrometry to look for fragments of spike protein in patient blood by first utilizing the protease trypsin in order to digest contents of the serum:

Mass spectrometry analysis was performed on the serum samples obtained from the recruited long-COVID syndrome patients, with the aim of detecting and quantifying spike protein fragments present in the samples. To achieve this, trypsin digestion was employed, generating specific tryptic fragments for each spike protein variant. The distinct tryptic fragments identified in the samples allowed for discrimination between the vaccine spike protein and the viral spike protein.

Trypsin is a protease that digests the carboxylate side of Arginine/Lysine residues.

Note that, protein-wise, the only difference between virus spike and vaccine spike is the swapping of two amino acid residues with proline residues, with the assumption that the proline residues would lock the spike into one conformation.

In regards to the vaccine one lysine residue was swapped for a proline residue, which would suggest that peptide fragments derived from vaccine spike would be inherently longer, or at least would contain one peptide fragment that is longer than virus spike.

Now, the actual length of these peptide fragments are what’s important, and to that the authors don’t provide any explanation for why they looked at these two peptide fragments in particular.

In this case, the authors looked at peptide fragments with a mass/charge ratio (m/z) around 830.3 and 979.4.

In short, mass spectrometry is an analytical method in which a compound gains/loses electrons in some manner. This causes fragmentation patterns of said compound, but it also leads to the introduction of different charges into the fragments. A detector then detects for these charged fragments and elucidates their size. It’s important to note that mass spectrometry is dependent upon the charged nature of the fragments. That is, if a fragment has a molecular mass of 500 but carries two charges it may appear on a mass spectrum as 250 (500 divided by a charge of 2).

All this to say that without any additional context we can’t know for sure what we are looking at when it comes to these mass spec results, or what peptide fragments the 830.3 and 979.4 are referring to in particular. Initially, I assumed that the 830 referred to virus spike protein whereas the 979 was derived from vaccine spike, but now I am not sure, and again the authors don’t provide any explanation for why they looked at these peaks in particular.

And even here the results are not very clear. When looking at the trypsin-treated serum of the 81 participants the researchers allege that they found fragments relating to virus spike in two patients and vaccine spike in one patient:

Out of the 81 long-COVID patients analyzed, fragments of the vaccine spike protein were found in 2 patients, while fragments of the viral spike protein were found in 1 patient (Table II).

Note that the actual Tables don’t tell us anything aside from descriptions of the results, because what sort of signal should we actually expect to see? It’s important that researchers explain what exactly is going on here, and yet this is all the information that is provided.

For all we know the results here may not pertain to any spike in particular. It could be any peptide fragment that the authors looked into. Again, it’s important that the authors explain why they chose these two peaks to examine.

So on its own this bit of information doesn’t help explain much because we can’t really tie the results to anything aside from having to trust that the researchers found evidence of continuously circulating spike (both virus and vaccine) even though this is “evident” in only 3 of the patients.

But that’s the least of the issues with this study. What’s rather concerning is the other experiment that the researchers conducted, and it’s here where a lot of problems arise.

In addition to the mass spec experiment the researchers also examined patient DNA for sequences that may pertain to the spike from the vaccine.

In doing so the authors conducted PCR of DNA extracted from patients:

The samples were obtained following informed consent and ethical guidelines. Genomic DNA was extracted from the blood samples using a commercially available DNA extraction kit according to the manufacturer's instructions (Blood DNA kit E.N.Z.A., Omega Bio-tek, Inc., Doraville, GA, USA or Exgene Clinic SV mini, GeneAll Biotechnology, Seoul, South Korea).

Note here that the authors use the phrase “genomic DNA”, and it’s from this phrasing that the authors may confuse naïve readers. Note that DNA extraction kits are generally non-selective. That is, most are designed to isolate DNA from whatever is within the sample. Or put within this context, there’s no way to extract a person’s DNA selectively for certain chromosomes or genes- it’s inherent within the extraction method that you are going to get genomic DNA for whatever you are extracting. It seems that some readers have looked at the word “genomic” and immediately thought of integration, when for all intents and purposes the word genomic is a nothingburger that just tells of something that most DNA extraction kids are designed to do.

The authors then conducted PCR on the DNA using primers alleged to be specific to Pfizer’s vaccine spike protein, with their results appearing rather sporadic. Note that we don’t know which vaccine some patients got, and 1/4 of the patients with available medical information didn’t even report being vaccinated.

The description of these results are as follows:

PCR amplification using the specific primers targeting the BNT162b2 vaccine spike protein sequence resulted in nonspecific amplification in 38 out of the 80 samples (Figure S1). No amplification was observed in 42 samples. A band of approximately 440 base pairs (bp) was detected, which corresponded to the expected size of the fragment amplified by the BNT162b2 primers.

There’s a few things worth noting here. Primers are oligonucleotides that are included during PCR to serve as a template for the polymerase. If no primers are used the polymerase won’t know where to bind along the DNA strand. Therefore, primers are used and are critical to the “annealing” step of PCR as the primers bind to specific segments of the DNA and allow the polymerase a site to start elongating.

Primers are critical to PCR and should be very specific to whatever gene you are looking at. If primers are nonspecific they could bind to any portion of a DNA strand, causing off-site amplification. The fact that so many nonspecific amplicons were found in the results may suggest that the authors used poor primers, but that may be the least of our concern.

Although the authors note that they amplified all 81 (80?) samples their results only show results for 18 samples when they ran their samples on a gel using gel electrophoresis:

Note that gel electrophoresis is a qualitative analysis. In general, you may run a gel to see if you have any amplicon at all. Otherwise, if no bands appear something may have gone wrong during PCR. You should also expect to see bands around your expected amplicon size, but remember that these are qualitative.

Note that gels are run with a DNA ladder. A DNA ladder is a collection of DNA fragments of various known sizes which serve as a frame of reference for your own aplicons. It’s needed because you otherwise won’t know what to compare your band sizes to. Here, it appears the researchers used a 1 kb DNA ladder, which would include DNA fragments in multiples of 100 bp starting from a 100 bp fragment and going up to 1000 bp, or 1 kbp.

Because the amplicon from the vaccine spike (at least using the primers that the authors did) is expected to be around 440 you would check to see if your amplicons fall between the 500 bp and 400 bp reference bands from the ladder.

Strangely, given the results above we don’t actually see any amplicon/bands around the 500/400 bp mark, but rather between the 600-700 mark. We can infer this given that the labeled 500 bp and 400 bp ladders fall below where the actual amplicon bands are, so this doesn’t quite correspond to the 440 bp that the authors suggest that they detected.

This could be the nonspecific amplification that the authors were referring to, but it again raises some quality issues. It also doesn’t help that the description of the results detail how many samples show either no amplification or nonspecific amplification, and yet the number of samples showing the intended 440 bp amplicon is never provided.

In order to solve this problem the authors turned to nested PCR. Nested PCR can be considered a two-step PCR method, in which two different sets of primers are used for each PCR step. A researcher may conduct nested PCR when one set of primers is nonselective. With the use of two sets of primers a researcher can filter out off-products since it would be less likely for nonselective amplicons to share two sets of primer binding regions as the intended sequence. This should, hypothetically, lead to cleaner products:

Note here that the significant aspect of nested PCR is the fact that two sets of primers are used.

Although the researchers conducted nested PCR they used the same set of primers twice (emphasis mine):

Due to the presence of nonspecific amplification in the initial PCR analysis, two rounds of Nested PCR were performed. The same primers and PCR conditions were used for both rounds. DNA extracted from the gel bands was purified using a gel/PCR extraction kit.

This is dangerous because if your primers are nonspecific to begin with nested PCR would only serve to continuously amplify these nonspecific amplicons because you wouldn’t provide a way to better select for the intended sequence.

This is made even worse given the description of how the authors included the samples that they did for the nested PCR step (emphasis mine):

To obtain specific and reliable results, two rounds of Nested PCR were performed on 12 selected samples that showed quality bands after the initial PCR (Figure S2). The second round of Nested PCR successfully amplified a single band of approximately 440 bp, closely matching the expected size (Figure S3).

What this appears to suggest is that the researchers didn’t choose ALL samples to conduct nested PCR on, but instead they seem to have selected for samples that show the 440 bp fragment size that they were looking for.

Even then, the two rounds of nested PCR still show a bit of nonspecific amplification, with a strange appearance of two bands outside of the 500-400 bp range in Figure S2:

So there’s already quite a few problems going on here. I’ll look closer into the primer sequence further on, but for now we’ll point to their Sanger Sequencing results, and it’s here where I have serious concerns for the author’s results.

As noted above gel electrophoresis is a rather qualitative approach in examining your amplicon. It only tells you the approximate range for your amplicon using the DNA ladder as a reference, but it can’t tell you what the exact size of your amplicon is, nor can it tell you the sequence of that amplicon.

One way of elucidating the sequence is to use a methodology called Sanger Sequencing. You can consider Sager Sequencing as gel electrophoresis with far better fragment separation and sequence analysis.

In short, Sanger Sequencing is a method in which you take your PCR product and undergo PCR one more time. However, this second round of PCR is rather different. Rather than just add in the typical reagents, an additional set of reagents utilizing truncated dNTPs (deoxynucleotide triphosphates, or the bases that make the building block of DNA) are included.

These truncated dNTPs contain modified 3’ regions and also contain a fluorophore (color-containing molecule) distinct for each modified base. During this second round of PCR some of these modified dNTPs may be added to the growing strand of DNA. However, due to their modifications they can’t continue their elongation, and essentially their inclusion into the DNA fragment results in elongation stopping abruptly.

The end result is that you have a stew of differently sized DNA fragments, and it’s here where a specific instrument known as a sequencer is used. A sequencer is a far more fine-tuned gel, in which the capillaries of the instrument are able to separate these many DNA fragments not by approximate size but by single base differences. That is, a sequencer can discern a 501 bp fragment from a 502 bp fragment, and can essentially separate all of these DNA fragments into their appropriate sizes.

Afterwards, the instrument is able to discern the last base in the sequence fragment due to the fluorophore.

For a clearer description ThermoFischer details Sanger sequencing in the following manner:

In order to determine the sequence, Sanger sequencing makes use of chemical analogs of the four nucleotides in DNA. These analogs, called dideoxyribonucleotides (ddNTPs), are missing the 3´ hydroxyl group that is required for 5’ to 3’ extension of a DNA polynucleotide chain. By mixing ddNTPs that have been labeled with a different color for each base, unlabeled dNTPs, and template DNA in a polymerase-driven reaction, strands of each possible length are produced when the ddNTPs are randomly incorporated and terminate the chain. The extension products are then separated by electrophoresis, resolved to single-nucleotide differences in size. The chain-terminated fragments are detected by their fluorescent labels, with each color identifying one of the terminating ddNTPs. The sequence of the template DNA strand can thus be derived by analysis (Figure 1).

The end result is that a chromatogram is constructed noting various colors at various base sizes, with software being used to discern what bases in particular are fluorescing:

So by utilizing Sanger sequencing a researcher can determine the actual sequence of their amplicon, and unfortunately this leads to probably the most egregious problem with this study.

First, let’s turn to the primers that the authors use, because this will tell us what sequence we should expect for the amplicon (emphasis mine):

PCR (Polymerase Chain Reaction) was performed using specific primers designed to target the spike protein sequence derived from the BNT162b2 vaccine (BioNTech/Pfizer mRNA Vaccine) (1). The forward primer (CGAGGTGGCCAAGAATCTGA) and reverse primer (TCTGGAACTAGCAGAGGTGG) were used.

The forward primer allows us to find the sequence within the Pfizer sequence. Here, we’ll use the sequence provided on github since that’s the sequence the authors use. You can find that sequence shaded below:

Note that this primer is intended to bind near the end of the spike sequence. This seems to be due to the fact that the authors are using a similar forward primer that was used by Aldén, et al.2 which is intended to target the end of the vaccine sequence:

The reverse primer is a bit difficult. In this case, you need to swap all the bases for their complementary base and read the sequence backwards. This should give you the following sequence to search for:

• CCACCTCTGCTAGTTCCAGA

Which can be found here within the 3’ UTR portion of the vaccine sequence:

Overall, what this tells us is that the amplicon found from the researchers should align with a sequence near the end of the sequence uploaded onto github.

And for further emphasis note that this is what the authors outline for their Sanger sequencing protocol:

The PCR products obtained from the Nested PCR were subjected to Sanger sequencing to determine the nucleotide sequence of the amplified fragment. Sequencing was performed in both the forward and reverse directions using fluorescently labeled dideoxynucleotides and a DNA sequencer. The obtained chromatograms were analyzed to confirm the presence of the BNT162b2 vaccine spike protein sequence in the genomic DNA of long-COVID syndome patients.

With on example sequence being shown below:

We’ll focus on (B), and note that the boxes point to areas of alleged homology between a sequence found in the vaccine vs the one from in one patient. Upon first viewing the boxed homology may seem scary, until you realize that there are several areas where there is no homology (i.e. the letters don’t match between one sequence and another).

This raises a lot of questions because if people are alleging vaccine integration then we should expect near 100% homology between these two sequences- the sequence shouldn’t vary greatly after integration, otherwise you wouldn’t be producing the same spike protein which the authors allege to have found with their mass spec results.

But upon further examination I wanted to look for where this one of these homologous sequences may be within the Pfizer vaccine sequence. In this case I wanted to see where the “AGCAATT” sequence appears. Again, remember that the amplicon should only reside near the end of the vaccine’s sequence.

But where does this homologous sequence appear? Strangely, rather early on in the vaccine sequence:

Weird, this shouldn’t be the case because the sequence should lie in between the two primers because that is what is being amplified. Readers can search for themselves, but I couldn’t find this sequence within the amplified region, and instead found it outside that region, which again shouldn’t be possible.

This raised serious red flags for me because how could the authors exactly find a sequence that they didn’t amplify? Remember that the authors themselves allege that they conducted Sanger sequencing using PCR product derived from their two primers, which again should only amplify the end of the vaccine spike sequence.

But the questions don’t end there. Afterwards I tried looking for the other homologous region “CGTG” to corroborate where this sequence is. Again, if we use the Pfizer reference that the author used we should find this sequence a few bases downstream from the “AGCAATT”.

But where exactly is this sequence? Not a few bases down, but in fact right next to the “AGCAATT” sequence (“AGCAATT” boxed in black and “CGTG” boxed in green):

This again, doesn’t make sense because the alignment shown above would suggest that these homologous sequences should be around 10 bases separated from one another- not right next to each other, so what exactly is going on?

This led me to look at the sequence they provide and elucidate what those dashes are within the sequence (boxed in red):

Now, there are several issues that may arise with Sanger sequencing which may lead to what are called “uncalled bases”. This can occur when your peak from your chromatogram is too off-center, in which case the software doesn’t know that a base is there and leaves it either blank or with the letter “N” for “not called”. However, if your sample is super noisy then the software may not be able to discern the proper call, in which case it may place several “N” calls rather than giving a clear answer, as is the case in the example below:

Initially I thought that these gaps were similar to these “N” calls in which case the author’s chromatogram may be more noisy than they expected. This would usually lead one to repeat the sequence, or to go in and make the calls themselves.

But given the base discrepancy between the homologous sequences from the author’s and from github this doesn’t appear to be the correct answer. That is, if a non-call was made for these bases we should expect a fairly decent size gap between the homologous sequences- the bases are there, but the software cannot make a call.

But this doesn’t appear to be the case because the homologous sequences are still there, but far closer together. This made me believe something else was going on.

To that, let’s remove the dashes and see what sequence we get. I’ll start from the “AGCAATT” sequence and move downstream/ to the right.

This gives us a sequence of:

• AGCAATTGCGTGGCCGACTACTCCGTGC

And if we search the github sequence we get:

Yupp- if we remove the dashes we get the actual sequence found on github.

This tells us one thing- the dashes are not uncalled bases, but are gaps acting as spacers between the bases.

So there are not missing/uncalled bases, but for some reason instead the bases are spaced out to appear as if there are bases there.

What’s rather interesting is that the software used by the authors allows you to insert/remove gaps in sequences:

So why is this a problem?

Essentially, this tells us absolutely nothing because by all accounts these sequences are useless. They don’t in fact show homology. Unless, of course, you include spacers/gaps…

If we remove the gaps from the patient genome and the Pfizer sequence, then try to align them what do we get?:

• AGCAATTGCGTGGCCGACTACTCCGTGC

• AGCAATTCGAASCACGTGCTTTACTATCAAGTC

Note that I’m using the “AGCAATT” sequence as a frame of reference, not because I believe this is a homologous sequence. And by removing the gaps you actually remove the two downstream homologous sequences, which adds even further evidence that these sequences were likely never homologous to begin with. Even worse, the sequences used as a reference in the Pfizer sequence shouldn’t even be found in the patient because they didn’t even amplify the pertinent sequence.

What all this tells me is that the findings here are useless- there are too many contradictions, questionable sequences used, and questionable alignment methods. Note that I’m not suggesting that the authors have inserted gaps to create the appearance of alignment, but it nonetheless makes me very suspicious of what methods they actually used and how they achieved their results. With that, the degree of ambiguity with this study is enough to warrant serious criticisms.

I have plenty of other issues with this study, but I’ll leave them be for now. I’ll just make note that it’s seriously disheartening that such a study has been widely disseminate without so much as a serious degree of scrutiny. It’s telling how readily people have accepted these findings without question if they are actually possible.

If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

Several people have reported on this study already (links below). I haven’t looked at it in full yet so this is a brief summary of what I have looked at so far, so please keep that in mind that the information below will be based on limited assessment.

Some people who have covered this article so far:

Igor’s Newsletter

Covid Vaccines Produce Random Junk Proteins Thanks to an "Invention" Which Coincidentally Won the Nobel Prize

Would you like to get a mystery shot, which would make your body produce random, garbage proteins for an indeterminate amount of time? Well, it turned out that mRNA Covid vaccines have precisely that effect! Scientists discovered that in addition to the toxic “spike protein,” mRNA vaccines have a weakness that introduces “read errors,” making vaccinated …

Read more

2 years ago · 534 likes · 411 comments · Igor Chudov

As several people have reported on by now, a recent study published in Nature1 appears to point to another flaw in the mRNA vaccines. In this case, it appears that some of the proteins being produced may not be analogous to the spike protein, but rather may be peptides formed by what’s called a ribosomal frameshift.

Before we begin

Frameshifts are somewhat common in both replication and translation. Most people know of frameshift mutations, in which bases may be inserted or deleted from either the reference genome or during transcription, all of which cause the downstream sequence of codons to shift over. Remember that translation, the process of forming proteins, is done in bases of 3. When the proper codon is recognized and the proper amino acid is inserted into the growing peptide strand this is called an in-frame insertion. If shifted over, this is referred to as being out of frame. Frameshift mutations can be rather disastrous when the insertion/deletion occurs in numbers not divisible by 3 because it leads to downstream codon shifts, which then lead to insertions of wrong amino acids and an overall protein that was not the initially intended product.

Translational frameshifts/ribosomal frameshifts are different than frameshift mutations, as these frameshifts are due to misreads of mRNA rather than mutations that may reside within the genetic sequence.

In this case, the end result is the same between frameshift mutations and ribosomal frameshifts as the downstream amino acid sequences end up being far different than what the intended sequence would be. However, frameshift mutations can be more harmful as translational errors may be minor relative to the entire pool of proteins produced.

As I’m not very creative Wikipedia has a layman’s example for ribosomal frameshifts:

Note here that the amino acid sequence doesn’t inherently “not make sense”. Rather, a better argument would be that it’s a mistranslation for what you would have wanted (i.e. it’s not quite in the language that you expected, which also may infer that the translated sentence won’t be useful). Amino acids are still incorporated, but they aren’t the ones you originally wanted and won’t have the initial function.

Along with wrong amino acid incorporations comes the possibility that ribosomes may also improperly frameshift and interpret stop codons where there normally wouldn’t be any, leading to truncated peptides. In this case, a shift over may lead to recognition of a stop codon that normally wouldn’t be there if the mRNA sequence was read properly, leading to the abrupt stop of translation.

In short, there are two forms of ribosomal frameshifts which are labeled somewhat counterintuitively. For the sake of this article note that the study in question refers to a +1 frameshift. The “+1” refers to the fact that, at some point during translation, the ribosome appears to shift forward one base, essentially skipping one base and causing a shift over to the right from what was originally intended. This is referred to as a “+1” frameshift if it is only one base slip to the right. There’s also the possibility of a -1 frameshift, in which the ribosome may move backwards one base which will also led to out of frame reading downstream of the frameshift.

Now, the reason for ribosomal frameshifts are not too clear. It appears that within the context of +1 frameshifts this may be a consequence of ribosomal stalling where the ribosome stops for a longer than expected amount of time. This may be due to the fact that tRNAs, structures which bear opposite codons to mRNA referred to as anticodons that help carry specific amino acids and extend the growing amino acid sequence, are not equally prevalent within cells. More “rare” tRNAs will have fewer probabilities of binding to its proper codon sequence, causing the ribosome to wait for this binding to occur. This may allow time for other tRNAs which can recognize out of frame but otherwise nearby codons to bind, leading to a frameshift.

Again, Wikipedia provides this example in which ribosomal stalling due to less prevalent Arginine-bearing tRNAs that bind to the codon CUU may allow for Glycine-bearing tRNAs to bind by recognizing a codon sequence that is one base to the right of the initial Arginine codon:

Keep in mind that the ribosomal stalling also serves to allow room for more thermodynamically favorable binding to occur, in which case ribosome bearing the previous codon may shift over to a more favorable spot and induce the frameshift (this appears to be the explanation for the scenario presented above).

Instances where ribosomal stalling takes place (as in the example above) are referred to as slippery sequences as they are regions where ribosomes may be more prone to slip and incur frameshifts.

This is an important thing to keep in mind when considering why the mRNA vaccines may be inducing frameshifts.

A brief look at the study

Again, keep in mind I haven’t looked at this study deeply so I’m only assessing things based on what I was able to understand.

First off, the researchers wanted to determine if ribosomal frameshifting was occurring with mRNA vaccines due to the fact that viruses are known to incur ribosomal frameshifts. In order to test their hypothesis the researchers utilized a reporter gene, in this case one that codes for the enzyme luciferase. Reporter genes are, by their name, genes that form proteins which can lead to detectable products. In this case, the use of a luciferase gene allows researchers to detect fluorescence by way of examining luciferase activity, with greater luciferase activity (measured through fluorescence by luciferin metabolism) inferring proper translated products (i.e. fewer ribosomal frameshifting).

In order to test this, researchers used one wildtype luciferase gene (WT Fluc- no, that doesn’t stand for “what the fluc”, although you may incorporate that into your own usage) in order to examine alterations in activity related to modified bases. In order to test the hypothesis of ribosomal frameshifts the researchers also utilized a modified sequences of luciferase. In this case, the modification was the insertion of a base that would code for a stop codon in the middle of the luciferase sequence.

This is a pretty interesting approach as all translations lacking any ribosomal frameshifts would lead to truncated luciferase since it would recognize the artificially created stop codon. Essentially, the researchers created a hurdle which can only be overcome if ribosomal frameshifting occurs.

Using the same sentence taken from Wikipedia, this would be similar as adding in a letter such as the B below that throws off the rest of the sentence, only in the case of luciferase the sentence/functional protein would be cut short:

Unmodified:

|Start|THE CAT AND THE MAN ARE FAT ...
|Start|123 123 123 123 123 123 123 ...

Artificial insertion leading to an out-of-frame sequence relative to the reference luciferase gene:

|Start|THE CAT BAN DTH EMA NAR EFA ...
|Start|123 123 123 123 123 123 123 ...

Note that this is a game of probability. Ribosomal frameshifting may occur at various points during the sequence/sentence, and so both a mix of truncated and properly translated luciferases should be expected. Rather, it’s the proportion of truncated or garbled luciferases (measured by reduced luciferase activity) relative to unmodified luciferase that’s important as it provides a measure of how often this frameshifting is occurring.

Put another way, in reference to the now garbled sentence above, the researchers are seeing if ribosomal frameshifts are occurring by measuring how often the inserted B would be skipped, which would then lead to the an in-frame reading, or otherwise the proper sentence/luciferase. Make the protein out-of-frame and see if the ribosomes can make them in-frame.

The results of this portion are noted below:

Note that (a) shows the normal luciferase gene compared to the gene which inserted a base to incur a stop codon (Fluc+1FS, with the stop codon noted with the *). The researchers used sequences that had regular, unmodified mRNA along with mRNA for luciferase that contained various base modifications. In this case the m1Ψ modification (denoting the methylated pseudouridine) is the important result here as they are the ones found within the mRNA vaccines, but note that various combinations of base modifications and pairings were used in this study.

(b) looks at luciferase activity when using the wildtype luciferase gene and different base modifications (shown on the bottom of the graph). In this case, we shouldn’t expect ribosomal frameshifts to occur outside of the normal rate (noted in the unmodified gene reference).

Interestingly, the use of wildtype luciferase modifications with m1Ψ appear to show reduced luciferase activity (argued to not be statistically significant) relative to the unmodified sequence. This would at least infer that something is happening during translation that is reducing the number of functional luciferase. There are several factors here, but the main assumption would of course be that some sort of frameshifting is occurring and causing non-luciferase proteins to be formed, or if formed are possibly truncated and non-functioning.

In (c) the gene sequence bearing the additional base (Fluc+1FS) is used, and here there’s a rather striking finding. In this case all of the sequences showed no luciferase activity aside from the sequence bearing the m1Ψ modifications. Again, remember that if no ribosomal frameshifts occurred we would expect no luciferase activity. Therefore, the fact that the sequence bearing the m1Ψ modification showed luciferase activity we can infer that some form of ribosomal frameshifting has occurred.

However, note that the scaling still suggests that not many of the ribosomes are able to overcome the hurdle. The unmodified sequence for the wildtype luciferase (Figure 1b) show activity around 15 million while the m1Ψ-bearing sequence shows activity around 10 million. In contrast, the luciferase sequence with the hurdle base shows activity somewhere around 1 million. Although there is still activity, there’s still a relative decline of 1/10 in luciferase activity, again suggesting that even if these ribosomal frameshifts are occurring it may be relatively rare. Remember, “relatively” is the important word here given that only 3 assays appear to be done across the study, as well as the fact that this portion of the study was done in vitro.

Also, note that luciferase activity was also lower when HeLa cells were transfected with the Fluc+1FS gene rather than free ribosomes, although this may be due to rates of transfection. Unfortunately, no wildtype sequence was provided as a comparison to see what type of activity would normally be expected.

Now, given these in vitro findings the authors turned to mice models to examine the extent of possible ribosomal frameshifts.

Remember that the intent of this study is to consider the possibility that mRNA vaccines may lead to +1 ribosomal frameshifting, and therefore individuals or animal models provided these vaccines should become sensitized to out-of-frame peptide products derived from the spike.

Here, mice were either left unvaccinated, provided Pfizer/BioNTech’s mRNA vaccine, or given the adenoviral-based vaccine. The use of the adenoviral-based vaccine serves to see whether this ribosomal frameshifting may be occurring in vaccines bearing unmodified bases.

It’s important to note that the mice in this study were given 3 doses of each vaccine rather than the typical 2 dose that were initially considered “fully vaccinated” in humans:

Mice of 8–12 weeks old were intramuscularly injected with three doses of 10 μg BNT162b2, 5 × 10⁷ infectious units of ChAdOx1 nCoV-19 or untreated. For booster immunizations, the same dose of the respective vaccine was injected 3 weeks and 6 weeks apart into the same site as the primary immunization.

After vaccination mice (at least cells derived from their spleens) were challenged with peptides derived from spike and peptides which are alleged to occur from +1 ribosomal frameshifts. Predict is the important word here, as the researchers didn’t necessarily take the vaccines and induce translation and isolate possible +1 ribosomal frameshift products. It appears that they used an in silico method of finding sequences and outsourced production of these out-of-frame peptides (emphasis mine):

To address this possibility, we vaccinated mice with BNT162b2 and quantified their T cell response to in-frame SARS-CoV-2 spike protein and +1 frameshifted products predicted to occur by translation of the mRNA +1 frame, as well as an unrelated control antigen (SARS-CoV-2 M protein), by interferon-γ (IFNγ) ELISpot assay.

Note that this pool of peptides used is rather exhaustive, as noted in the following table. +1FS spike refer to those peptides predicted to come from +1 ribosomal frameshifting:

Also, keep in mind that the researchers are examining immune responses by looking at T-cells. In particular, they are measuring interferon-γ (IFNγ) responses, which may infer immune system activity.

The results of this portion are noted below:

Note that the graph on the left is showing responses to the predicted out-of-frame peptides across the different mice groups. The SARS-CoV-2 M group seems to have been thrown in as another negative control. The right graph examines these same mice’s responses to peptides derived from the in-frame predicted spike peptides i.e. responses that should be expected towards the spike.

In both vaccinated groups mice show a clear IFNγ response to in-frame spike peptides. The untreated mice appear to show limited responses, although remember to watch out for scaling (the y-axis for (c) appears logarithmic) and so the responses seen in untreated mice may be noise.

What’s important for our sake is the response to the +1 frameshift predicted peptides (Figure 2b). Here, there appears to be a clear, distinct IFNγ response in mRNA-vaccinated mice, suggesting that possible frameshifting may be occurring.

It’s important to note that, similar to the in vitro models, the difference in responses are by orders of magnitude, which would be expected as ribosomal frameshifting should be occurring abundantly. Because of the logarithmic graph for the spike it’s hard to discern the actual proportion of in-frame: out-of-frame peptide responses. We also don’t know what rate of ribosomal frameshifting should be expected in the first place.

When comparing responses in humans the effect doesn’t seem as strong, although still somewhat noticeable.

Here, 21 vaccinees of mRNA vaccines and 20 vaccinees of adenoviral-based vaccines had their blood drawn and measured for IFNγ responses:

We then compared IFNγ ELISpot responses to predicted +1 frameshifted SARS-CoV-2 spike protein products in 21 individuals vaccinated with BNT162b2 and compared these responses to those of 20 individuals vaccinated with ChAdOx1 nCoV-19, none of whom reported undue effects as a result of vaccination.

Unfortunately, this is where problems start to arise and where media reporting goes off the rails.

Note here that the researchers never mention how many doses these individuals received. They also don’t provide any information on prior infection history based on what I’ve looked at.

This is important because the mice used in this study were given 3 doses of each vaccine. We can hypothesize that more doses would mean more chances for ribosomal frameshifting to occur, and so this would be one correlate that isn’t being looked at in this study. For instance, fewer doses of the mRNA vaccines may mean fewer out-of-frame peptide formation and therefore fewer immune responses to these frameshifted peptides. There’s also a possibility that increased exposure to the virus itself or the unmodified adenoviral-based vaccines may have a chance of increased ribosomal frameshifting (a speculation here).

And so we can’t really tell much about these participants aside from which vaccines they got. It’s rather strange that this study seems to lack any description of these patients that would be pertinent.

The results here are also not that impressive:

Similar to the mouse graphs the left shows IFNγ responses to frameshifted peptides while the right graph shows responses to in-frame peptides.

Relative to the mice models the responses here are far lower, although this could be due to the fact that blood samples were taken from vaccinated participants whereas the mice had their spleens removed and examined, so it’s possible that this may have led to the stronger response in mice due to more responsive cells.

But even with that being said, note that the responses in Pfizer humans are rather sporadic, appearing to be driven by 2-4 outliers in particular. Like with everything, the important question isn’t that some people show responses to frameshifted proteins, but why some people show these outlier-like responses.

Keep in mind that the sample size is also small for such a study, and given that no control was used we don’t know what the background rate to these frameshifted peptides should be. Remember that we don’t even know how many doses of each vaccine these participants were given.

There’s also the fact that some of the AZ participants showed an IFNγ response. The overall breakdown can be found in the spreadsheet below with green noting the mRNA vaccinees and blue noting the AZ vaccinees who showed an IFNγ response:

To include or not to include…

At this point you may look at the AZ responses and consider them negligible. If that’s the case, I would rebut that argument with the following:

Let’s suppose that we should expect no response at all to these off-proteins.

If that’s the case, then we may allege that 7/21 Pfizer vaccinees and 4/20 AZ vaccinees show immune responses to off-proteins, or around 33% response vs 25% response, respectively. Would these be comparable? I’m not sure given the very small sample findings.

And if this seems like me being a pedant note that Science covers this study with the following remark:

Blood samples from about one-third of the Pfizer recipients showed an immune reaction to the frameshifted proteins, whereas none of the samples from AstraZeneca recipients did. None of the people reported any side effects from their particular vaccine, and there is no evidence, the researchers say, that the frameshifted protein is harmful.

It seems Science included all Pfizer participants who showed a response, meaning that this “no response” comment doesn’t quite work for AZ vaccinees. It’s obvious that some AZ vaccinees showed a response, so why report that none did?

It seems that reporting here may be doing a bit of number manipulation. It’s far easier to make things sound worse than they may appear when percentages are used, especially when sample sizes are as low as they are in this study.

One-third or 33% sounds rather scary. 7/21? Maybe not so much, and remember that this 7/21 is based on a sample size which we have no thorough information on, so we can’t even extrapolate this to larger populations.

Something that leads to nothing

The overarching problem with this study is that there is no way of interpreting the findings. How much of an immune response to off-proteins would be considered tolerable? What is the threshold, and what exactly is the background rate? Did people within the AZ produce an IFNγ response or not, and what measure would you use to make that argument to include or exclude?

And are these proteins harmful or not? I’ll break from both sides and say that this study and any inference from it can’t provide any comment for or against possible adverse reactions.

On one hand, the Science article and the researchers are makings claims that the off-proteins aren’t doing much:

None of the people reported any side effects from their particular vaccine, and there is no evidence, the researchers say, that the frameshifted protein is harmful.

No evidence from the researchers they say? And what evidence did the researchers provide to make that claim?

The only evidence I could find was the remark from the above excerpt which noted that none of the vaccinees reported “undue effects” due to the vaccines…and that’s about it- a highly subjective response from participants that they were OK after vaccination. Nowhere is additional information provided about these individuals medical background or of any tests conducted to confirm this assumption.

Remember that absence of evidence is not evidence of absence. Just because a participant says they didn’t notice any adverse effects does not mean something didn’t occur.

On the other hand, several people have taken to speculating that these off-proteins may be harmful. They are, after all, unintended products. But note that translation is not a 1:1 perfect process. Viruses appear to utilize frameshifting in order to produce some of their structural proteins, seemingly using this method as a form of cramming in more functional proteins into a smaller genome.

Crappy proteins are often made by the body as well- it’s usually when the threshold for too many misfolded or poorly-translated proteins is met that an issue may arise.

Again, the problem here isn’t whether these off-proteins are safe or harmful. We just don’t know because this study wasn’t designed to measure that, and any comment to the contrary would be mere speculation.

AND, if one were to argue that these off-proteins are harmful, it would have to rationalize the distinction between Pfizer/mRNA adverse events compared to adverse events found with the adenoviral-based and protein-based vaccines.

In short, this study can really be boiled down to the following:

1. Some people produce immune responses to off-target proteins. Which people? We don’t know. Maybe those given mRNA vaccines, but we don’t know how much is concerning or if other reasons may explain any outliers.

2. We don’t know what the response to these proteins, or what the proteins themselves mean since nothing was tested to show something one way or the other.

Personally, that’s all I can derive from this study.

Now, as to why this frameshifting may be occurring, the authors surmise that m1Ψ-rich codons may be causing the stalling as the ribosomes have difficulty parsing what codon they are actually reading. This seems to be supported by the fact that some of the off-protein products occurred at these m1Ψ-rich codons (Figure 4), thus suggesting that m1Ψ-rich codons within the mRNA vaccines may serve as slippery sequences.

If true, the results of this study are rather paradoxical to what we’ve been told about these vaccines. Note that one concern was that these mRNA vaccines have been codon optimized. Following the logic I mentioned about regarding rare tRNAs, codon optimization is when a codon for one amino acid is swapped for a different codon that still codes for that same amino acid. In this case, the swap is from a rarer tRNA to a more common one which may speed up translation, essentially removing possible ribosomal stalling as the ribosome waits for that rare tRNA. This has been alleged to produce possible off-proteins structurally, as speeding through translation may not allow room for proper folding of proteins during ribosomal stalling.

In contrast, if these m1Ψ-rich codons are themselves ribosome stallers then it seems as if the effect of codon optimization would be reversed. Ironically, the Science article themselves suggest that a correction would be to remove these m1Ψ-rich codons for ones that bear fewer m1Ψ:

But there’s a simple solution, the researchers say. Because mRNA can use several codons for a given amino acid, the molecules can be designed to avoid the slip-prone codons. For example, mRNA designers can use the sequence UUC (two pseudouridines and a cytidine) instead of UUU (three pseudouridines). Both code for the same amino acid, but the former should produce fewer errors. It’s a bit like writing mom instead of mum, Willis says. “It means the same thing.”

So in order to solve the problem of m1Ψ-rich codons you should… use less m1Ψ? Seems like creating a problem then offering a solution to said problem…which was just the original thing to begin with…

Anyways, I’ll leave readers with that. If anything needs clarifying please feel free to ask! Hopefully I can respond if not busy with Christmas and life-related things.

If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

For many of us who lost our jobs, livelihoods, or businesses over being unvaccinated, we are all too aware of the prejudices and widespread social gatekeeping that went on for a good portion of the pandemic.

It was an obvious demonization that was justified by those in power, even when it was quite obvious that the vaccines were not the saving grace that they were alleged to be.

That being said, there’s been a rather large gap of ignorance among mainstream outlets, many of which seem to focus more on circumventing the serious issues in vaccine passports over a “vaccine passports, please” worldview.

So it’s a bit of a surprise to note a website pointing to a study pointing out many of the hypocrisies brought forth by vaccine zealots.

A few days ago the website PsyPost pointed to a study detailing the blaming of the unvaccinated for many of what went on during the pandemic:

I don’t provide much credit towards PsyPost, or really any outlet as they are likely to publish articles on the basis of getting clicks. The article itself creates a framework in favor of the vaccines, although it quickly raises criticisms about the stigmatization and demonization that went on for those of us who chose not to get vaccinated, and more importantly how many of us were used as scapegoats (possibly as a means to blame us for the high hospitalization rates and ongoing pandemic):

However, this emphasis on vaccination has also given rise to a complex social phenomenon – the stigmatization and prejudice faced by those who choose not to get vaccinated against COVID-19. A recent study published in the Journal of Medical Ethics aimed to investigate whether the negative sentiments directed towards the unvaccinated can be considered a form of scapegoating.

A quote provided by the study author interestingly points out the blatant hypocrisy in many of the studies and psychology/sociology studies that came out during the pandemic which tended to examine conspiracy theorists and those who are vaccine hesitant as sources of misinformation, rather than examining possible misinformation touted by vaccinees:

“My colleagues and I have been studying the social divisions surrounding COVID-19 for some time. We have noticed that much of the existing research at that time focused on conflicts originating from people who discount COVID-19, believe in conspiracy theories, and generally undervalue the threat of the virus. We replicated many of those patterns in our own research as well,” said study author Maja Graso, an assistant professor at the University of Groningen.

“However, what we found to be missing was an address to misinformation and the consequences stemming from overestimating the threat. Consider, for instance, how in 2020, more than 30% of Americans believed that a COVID infection led to a 50% chance of hospitalization; it never did, nor was there ever evidence to suggest it might. Left-leaning individuals tended to over-estimate COVID harms to a greater degree than conservatives.”

This is a serious problem that never seems to have been addressed, especially due to the fact that misinformation over the sterilizing and protective nature of the vaccines led to social validation to stigmatize and push out those of us who chose not to get the vaccines. It was a social phenomenon justified by public acceptance of lies rather than actual scientific evidence.

Keep in mind that the there were vocal comments to blame us unvaccinated for surges in cases stemming all the way back from mid-2021:

The study in question1 seems to have been published in June but only recently appeared in my news food so apologies for any redundancy if others have already covered this article.

Even though the article starts out praising the vaccines, it quickly criticizes much of the accepted hypocrisy regarding misinformation surrounding the vaccines, including the fact that many otherwise healthy people are not likely to be hospitalized for severe COVID, the fact that vaccines are not sterilizing and therefore both vaccinated and unvaccinated can transmit the virus, as well as the fact that natural immunity has been mostly ignored by the public as well as those within the medical profession.

Here’s an example of one of these blatant hypocrisies:

Of course, self-protection is not the only benefit of vaccines. Even if the vaccinated person is not at high risk of getting seriously ill, they may reduce their chances of passing the virus on to somebody who is.²⁷ This rationale has been a common moral justification for mandating vaccination in general.²⁸ Yet, as early as mid-2021, it was known that C19-vaccinated individuals could acquire an infection and transmit the virus to others.^29–32 At the height of their infection, both vaccinated and unvaccinated individuals have similar viral loads,³² though vaccination may expedite the clearance of the virus.³⁰ The effectiveness of the primary vaccination series as well as boosters decreases over time.^{33 34} Subsequent variants of concern in 2021, notably Delta and Omicron, also reduced aspects of vaccine benefits.²⁷ Moreover, there has been ambiguity about the benefits versus risks of C19 vaccination for low-risk groups,³⁵ especially children and young people under 30 years old.³⁶

The study was separated into two vignette-based studies, in which people were provided a scenario and asked to provide answers to their perception of the scenario.

The researchers’ proposed hypothesis involved believing that those surveyed are more likely to blame the vaccinated as scapegoats, even when the evidence did not warrant blaming them for the ongoing pandemic:

First, we expected that people would be more likely to scapegoat an unvaccinated (than a vaccinated, or unvaccinated-recovered individual). We expected this effect to emerge regardless of proportionate risk considerations that would suggest that scapegoating of the unvaccinated individual is unwarranted (ie, age, comorbidities, timing and history of vaccination or prior infection). Second, we examined whether liberals would be more likely to scapegoat the unvaccinated (relative to the vaccinated) individual than conservatives.

The first study involved a made-up profile of 4 individuals: 2 young adults with a less than 1% risk of hospitalization and death, as well as 2 older, more higher risk individuals. The profiles included a description of either vaccinated (3-doses), unvaccinated, and unvaccinated but recovered prior to vaccine rollout. Patients were asked to rate the culpability of these profiles from a scale of 1-6 based upon the following questions:

Specifically, we asked participants to indicate on a scale from 1=not at all to 6=very much the extent to which the character is: (1) to be blamed for the effects of hospital staff shortages, (2) at fault for C19 deaths and hospitalisation and (3) guilty of severely jeopardising his/her community’s public health. We also asked participants to estimate the likelihood that the character will: (1) be hospitalised for severe illness, (2) die and (3) not recover.

In short, across all profiles those who were described as either unvaccinated or unvaccinated and recovered were rated higher regarding their culpability:

The data here is rather alarming, as not only did participants suggest that someone fully recovered from COVID will likely be at high risk of hospitalization and death (as if they didn’t have it before…), but also that all of the proposed risk percentages fell far above the actual statistics, suggesting that there’s an overall over assumption of COVID risks among included participants.

When stratified based upon political preferences, the study noted a wide discrepancy, with Trump voters rating the scenarios lower in culpability for the individuals in contrast to Biden voters. Keep in mind that party affiliation is assumed based on who participants voted for, and certainly don’t provide an accurate comparison of results with respect to actual party:

Again, be mindful that party affiliation shouldn’t readily be assumed for this scenario given that Trump voters may not necessarily be conservatives and vice versa.

In contrast to the first study, the second study provided a scenario of a low-risk, relatively healthy male who spends all day working outdoors and spending time by himself, with the only difference in the scenario being the individual either being unvaccinated and having gotten COVID with no issues and fully recovering (labeled U-R), or of the individual getting 2-doses of the vaccine but not being up-to-date with a booster (this survey took place early 2022; labeled Vax):

In our second study (February 2022), we asked 193 participants from MTurk (M_age=39.19, SD=12.44, 47.4% men) to evaluate a 28-year-old, low-risk male character who is ‘in general, fit, healthy, and enjoys spending as much time outdoors as he can. He spends most of his work time outside by himself’. Participants were randomly assigned to a condition in which the character has either:

1.‘contracted COVID-19 in May of 2021 (around the time when he was eligible to receive his vaccine). He did not seek medical attention, and he recovered fully’, or

2.‘received two doses of the COVID-19 vaccine in May of 2021 when he was eligible to get it (he does not plan on getting a booster)’

The author’s assumption in this scenario may be slightly unfounded, as both scenarios were constructed to likely receive a similar degree of culpability and scapegoating. So natural immunity and being outdated may not be easily comparable as suggested.

Nonetheless, when participants were asked to score these scenarios based on the criteria from the first study participants still rated the man from the U-R scenario as being more culpable:

It’s rather ironic that this individual scored so highly for the U-R vignette even though it was outlined that this person did not require hospitalization and fully recovered.

It’s curious why, even when presented with this fact, that participants still rated this individual as being at high risk of hospitalization and death when the vignette itself said that his prior infection led to not needing hospitalization and fully recovering. It’s almost as if participants disregarded prior bouts of COVID as providing any prediction of future infections.

Note, again, that even though these scenarios were scored/rated lower relative to the individuals in the prior study, they still appear to be over estimations of actual risk.

Overall, the study notes that, at least among participants, overall evaluations of COVID risks were grossly exaggerated, and more importantly people were more likely to find those who were unvaccinated to be culpable for prolonging the pandemic and causing many of the hospital shortages.

This is what makes the blaming of unvaccinated scapegoating, as the researchers note that scapegoating requires utilizing unfounded and unscientific evidence to blame others:

Recall that what makes blame assignment a form of scapegoating (vs a justified response to a social threat) is that it is driven by fear or based on unfounded or inaccurate facts.^{10 11 13 63 64} We provide evidence that the scapegoating of the unvaccinated was not grounded in available empirical facts, but a miscalibration of risk. Our evidence for this is that while participants recognised that the elderly and people with severe comorbidities were at higher risk of hospitalisations or deaths (vs low-risk characters), they consistently overestimated the risks of C19, especially for the unvaccinated people who are not in a known high-risk group. These inaccurate risk estimates comport with results from representative sample-based studies available at the time.^{17 18 55} The final contributing factor to misperceptions, and another indication of scapegoating, was the failure to consider the protective effects of prior infection, which were known according to the evidence available at the time of our data collection.^{40 43}

Put another way, if you were to blame a group of people you’d better make sure you are relying on accurate evidence, and it’s rather apparent that a lot of misinformation regarding actual hospital rates and death associated with COVID was unfounded.

I’ll leave the implications portion for readers to read for themselves. Again, this study doesn’t tell us anything that we otherwise are already aware of or have experienced for ourselves.

It at least points out that misinformation can come from all sources. It’s rather arrogant to assume that people who you agree with will always be aboveboard in what they provide to you.

I can probably expound upon this some more, but I believe Maja Graso summarizes it rather well in the PsyPost article:

“It conveys a classic, timeless message: people should be aware that good intentions can run awry,” Graso said. “We encourage everyone to consider that misinformation can come in many forms and from many sources. Just as undervaluing the threat can be damaging to public health, lives, and resources, vastly overestimating the COVID-19 threat can also create pressures that lead to poor policy decisions, diversion of resources, and unwarranted blame of individuals who may not be at fault.” […]

“Our own ‘political tribe’ can also be a source of misinformation, yet we may be less adept at recognizing it,” the researcher added.

---

If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

Recently the CDC approved ANOTHER round of COVID vaccines from Pfizer/BioNTech and Moderna, this time utilizing mRNA for a monovalent spike from the now-mostly extinct XBB.1.5. or ‘Kraken’ variant that appeared in early Winter 2023.

We’re way past the mythological creature naming part of the pandemic, and have moved onto astronomical (literally) naming criteria such as ‘Eris’ (EG.5) and ‘Pirola’ (BA.2.86). Or maybe they are named after mythological gods and deities. Not sure, and quite frankly it’s not the major issue with these variants.

Supposedly, out of the 14 people on the panel who voted for this approval the voting resulted in a 13-1 ‘yes’ vote for those 6 months and older. I’m rather curious who the dissenting vote was…

Strangely, Novavax, the only US-based company to produce a protein-based vaccine, has been updating their vaccine along with the mRNA manufacturers without much remarks about their updated vaccines, and even their initial Wuhan spike-based vaccine has not seen full approval. Novavax reported some of their XBB.1.5 spike results to the CDC, and yet it doesn’t appear that Novavax is on the “updated” vaccine list this coming season.

Slideshows from the different vaccine manufacturers presented to the panel can be found in the links below:

• Pfizer/BioNTech: Monovalent XBB.1.5 BNT162b2 COVID-19 Vaccine

• Moderna: Safety and Immunogenicity of Moderna COVID-19 Vaccine (2023-2024 Formula) Monovalent XBB.1.5 Variant Vaccine

• Novavax: Data in Support of Novavax XBB.1.5 Vaccine

It’s sort of the same old process that we have seen before. Both Pfizer/BioNTech and Moderna utilized pseudovirus assays in order to test the neutralizing capacity of antibodies sourced from a small pool of mice given these vaccines.

Pfizer/BioNTech seems to have gone the mouse-only route. They mention a clinical study design in their presentation, but it doesn’t seem like any results were provided. I’d have to look at the committee meeting in order to see whether any clinical trials were actually conducted for XBB.1.51.

The ‘Summary’ slide for Pfizer/BioNTech (Slide 13) seems to suggest that no clinical data was used to argue for the approval:

Note that preclinical refers to in vitro and animal models, and so this seems to argue that both no clinical studies were conducted/reported, and that vaccine manufacturers don’t seem to need to conduct clinical studies in order to update their vaccines.

This report only focused on a mere 10 mice in the XBB.1.5. group for this study (10 were given BA.4/BA.5 bivalent while 10 were given XBB.1.5):

In contrast, Moderna seems to have conducted clinical trials, albeit small, testing a monovalent XBB.1.5 spike mRNA vaccine against a BA.4/BA.5 and XBB.1.5. bivalent mRNA vaccine. Both groups had around 50 participants each, and so any serious adverse event that would be worth monitoring for would likely not appear in such a small sample size. Moderna provides some of their safety data (Slides 6 and 7), but again this is rather meaningless given the small sample size and lack of any clarity of serious adverse events.

Unfortunately, even with a clinical study only neutralizing results were provided:

This focus on antibodies has been extremely harmful, since it overlooks other aspects of the immune system. This may partially be due to the fact that dissemination of information to the public is made easy by focusing on antibodies alone, but gross simplification of the immune system isn’t a good way to inform the public. Things shouldn’t be made easier so that they appear more palatable to people.

Or maybe the CDC doesn’t require actual cellular immunity studies, and so this is all that becomes important.

Novavax provides some evidence of cellular immunity in their presentation, although this seems to be in non-clinical, rhesus macaque animal models that were only provided two doses of XBB.1.5 spike-containing vaccines rather than the “currently “recommended” vaccine schedule along with an XBB.1.5 booster. This also appears to have been done in only 5 macaques, so it doesn’t tell us much about the effects in those given more than just the XBB.1.5 vaccine.

I guess that’s better than just neutralization assays, although all of this points to the fact that robust testing hasn’t been done for even these boosters, let alone the primary vaccines and boosters.

The fact that several different vaccine manufacturers are able to seek approval using different studies should raise some concern. The argument over vaccination relies on the data being used as evidence, and if these manufacturers are looking at different data to push for their vaccine’s approval then there’s likely to be a great deal of inconsistency.

The point in posting this data isn’t to argue whether these vaccines are effective or not, because quite frankly these studies just seem too minimal to provide anything really meaningful in the real world. They certainly don’t explain how the majority of people will respond to these vaccines, and they certainly don’t provide any relevant insights into the safety and efficacy of these vaccines. This comes with the fact that so much is still not known about these adverse reactions and possible deaths following vaccination.

It’s really more of the same to be quite honest, and yet people are continuously being sold the idea that continuous vaccination will be what’s needed to deal with increasing COVID numbers, along with masking and even lockdowns in some areas.

We’re not in the same position we were 3 years ago, and we certainly should know better to fall for media trickery that may induce a sense of fear and paranoia in order to sell us a cure. The vaccines haven’t helped us out of the pandemic so far, so why would THIS be the time for it to happen?

We need more people to move on, to not feel the need to keep getting vaccinated, and to live their lives not in fear.

Substack is my main source of income and all support helps to support me in my daily life. If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

1

Slide 5 seems to provide even more support that no clinical data was provided at the time of approval, given that it refers to XBB.1.5 clinical data as “ongoing”.

Subscribe now

Share

I admire the work that Bret Weinstein and Heather Heying put out, including on their Darkhorse Podcast. It’s always interesting to see how their mind works and how they perceive the world. Heather tends to be a clear example illustrating how one goes out and views the world, including such examples as when she mentions one of her PhD mentors who would take her and other students out in the wilderness and make remarks such as, “look at all of the questions!” I can’t recall which mentor she refers to in particular, but it serves as a reminder that we tend to assume that things are just out there without understanding how those things operate, or why they may operate in the manner that they do.

Although I find both of their works to be enjoyable and generally food for thought, there are some moments where I have found issues in their interpretations of data.

Part of this is due to my own conceptualization of information. I’m more mechanisms-driven relative to other people and I’ve become more aware of that the more I write. I don’t like the basic explanation of “X treats Y”, but am more curious of how X can treat Y. What exactly is going on that seems to explain the relationship between the two aside from the fact that using X makes Y go down…somehow. This is just a minor aside and is just one noticeable difference in my thinking vs Bret and Heather’s way of thinking for some concepts.

When it comes to COVID one thing I have drawn criticism of is Bret’s model of heart damage, in which he refers to the targeting of the heart by the vaccines as an autoimmune event. More specifically, he uses the argument that the heart via transfection of the mRNA vaccines will lead the production of spike within the heart, which would then be targeted by the immune system and be removed, in which case the immune system’s attack on the heart can be considered an autoimmune-related response. He also suggests that this event isn’t related to the heart in particular but any cells that are made to express spike protein.

For context, he made such comments in a recent Darkhorse Podcast episode (timestamped below):

There’s a lot to consider in regards to why and how myocarditis presents post-vaccination, but for all intents and purposes this justification of autoimmunity doesn’t quite work because, well, it’s not quite autoimmunity.

Autoimmunity refers to a phenomenon in which the immune system directs attacks against the body’s own antigens, whether through targeting self receptors or other proteins within the body normally produced by our own cells.

For instance, Type 1 diabetes mellitus is argued to be related to autoimmune responses in some individuals (termed autoimmune diabetes mellitus or Type 1a diabetes)1, in which case the immune system inappropriately targets the insulin-producing cells of the pancreas called beta cells.

Note that the critical factor in autoimmunity is the auto part, or “self”. It’s the inappropriate recognition of self antigens by the immune system that causes these diseases to manifest.

It’s also worth noting that there appears to be evidence of autoimmune responses following a severe COVID infection, as well as post-vaccination:

But again, in these cases of autoimmunity the immune system somehow incorrectly targets self antigens, possibly by way of cross-reactive antibodies that target both the virus/spike antigen as well as our own proteins.

All this to say that targeting of the spike in transfected cells doesn’t quite fit the definition of autoimmunity because our own cells don’t normally produce spike protein. It’s also the fact that this doesn’t mean that the immune system may be incorrectly trained to target the heart if it was made to express spike protein.

It’s one of Bret’s models that I had a bit of trouble rationalizing, and to be honest I didn’t give it much thought until Jessica Rose’s recent piece that also emphasized that this wouldn’t fit a model of autoimmunity:

Unacceptable Jessica

Spike-mediated (CTL)-mediated immunity is NOT autoimmunity

This article is really important and draws attention to the distinction between autoimmunity and acquired T and B-cell-mediated immunity. We can define the difference using only two words: self and foreign. I wrote these words before here: “The thing that people are talking about with regard to injection-related spike embedded cell destruction, is not a…

Read more

3 years ago · 188 likes · 41 comments · Jessica Rose

This article is really important and draws attention to the distinction between autoimmunity and acquired T and B-cell-mediated immunity. We can define the difference using only two words: self and foreign.

I wrote these words before here:

“The thing that people are talking about with regard to injection-related spike embedded cell destruction, is not autoimmunity. It is the immune system working properly to clear cells with destroy-me flags on their surfaces.”

Bear in mind that the immune-mediated clearance of spike-producing cells isn’t far off from what the immune system normally does to an infected cell anyways. A virus enters into a host cell, begins producing genetic material and proteins, some of which may be collected by the infected cell and presented on the surface. Immune cells tasked with surveying cells to make sure that they aren’t produce wrong peptides would then target these cells for destruction.

That’s not what that means…

Far be it from me to argue that terms are being used inappropriately. I’m learning things as I write, and because of that I have misused terms in the past and more than likely will misuse terms in the future.

That being said, what’s becoming a bit apparent is that the misuse of words has become rather common, and when it comes to dissemination of information misuse of words may lead to improper interpretations.

Although I much admire Bret and Heather, I will also argue that Bret’s model is a bit simplistic, and it doesn’t quite fit what we would consider to be an autoimmune phenomenon. It would be a bit improper to reinterpret autoimmunity in such a manner, especially if cells of the heart are being made to produce spike. You don’t need to rely on a justification of autoimmunity to explain that the death of heart cells is not a good thing.

Bear in mind I’m viewing this perspective from the idea that the heart is being transfected. This argument seems to be highly controversial, and a study from Barmada, et al.2 that Bret and Heather have cited once has even argued that autoimmunity does not seem to be the reason for myocarditis, but may be related to cytotoxic immune responses that may lead to heart damage, although I’ve raised some issues with the study’s design and authors’ denouncements of other hypotheses.

Even with these issues, the Barmada, et al. study would at least contradict an autoimmune model proposed by Bret.

It’d be interesting to see if Bret reworks his model and provides better context for his model, but this is again an issue in which terms may be used that are distant from their original meaning.

Not to sound like a broken record, but we’ve seen this when it comes to original antigenic sin in which everyone and their mother seemed to have a different, rather superficial definition of what OAS is, and yet everyone’s definition seemed to appear correct. It doesn’t help that many studies that looked at immune imprinting or OAS fail to have proper study designs that actually model OAS.

We’re seeing this now with “VAIDS”, which simultaneously draws parallels to AIDS but also doesn’t fit the model of what AIDS is.

Untreated AIDS should, hypothetically, lead to continuous depletion of CD4 cells and waning immunity. People within the early stages of AIDS may not recognize that they have AIDS because their body can sufficiently deal with infections. However, as the disease progresses and the immune system weakens then the ability to deal with infections gets worse, and otherwise mild infections may lead to worse illnesses in these AIDS patients. It’s argued that many AIDS patients die from secondary infections due to their inability to deal with infections.

VAIDS, if invoked, should fit a model similar to this. We should expect people to not only get sick more frequently but to also be even worse off without intervention, and eventually many people are likely to succumb to secondary infections.

The problem I have with VAIDS is that the former (more frequent infections) are used as an argument that the latter (worse illness and death) is occurring. It’s true that many people, and children in particular, are getting ill more frequently. However, it doesn’t appear that these illnesses are leading to far greater degrees of hospitalizations and death, and we probably shouldn’t expect people to be able to manage their frequent illnesses at home if their immune systems are shot.

And yet VAIDS continues to widely circulate. I even see saw someone mention that Megyn Kelly’s recent remarks about testing positive for some sort of autoimmunity is an example of VAIDS. Great, that just means that there is even less consistency in a made-up word and anyone can define VAIDS whichever way they see fit.

This is one of the growing issues in which terms that are used as a term of art with a clear definition may become bastardized when used colloquially, so now the term has a different meaning in the public eye, and is made worse when the colloquial definition is used to refer back to scientific ideas or concepts.

I find it strange that there tends to be this high degree of inconsistency. There’s a cultural argument over the colloquial use of “gender” and “sex” compared to the scientific use of these words, and yet these same people may use scientific words colloquially to infer whatever they want.

And because of this inconsistency there isn’t a proper method of organizing ideas. Words can mean whatever they want so long as it harkens back to your group or invokes some idea of hysteria.

Words have meaning. Words used within a specific context cannot be overgeneralized to refer to ideas or concepts. And more importantly, words allow us to disseminate information in a consistent manner. We can’t do with words whatever we see fit.

Substack is my main source of income and all support helps to support me in my daily life. If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Apologies for the delayed posting of this article. I had some things going on over the weekend, and last minute found out someone was going to be visiting and had to scrambled to do some additional cleaning/organizing. As a heads up, if anyone is traveling this holiday season PLEASE alert friends and family weeks in advance, not DAYS!

Anyways…

This study1 has gotten a lot of attention for a possible conclusion of weakened immune systems post-vaccination, and more alarmingly a possible risk in children that hasn’t been studied before.

The prior article raised some food for thought, although it was initially intended to be an assessment. I guess my thoughts went down different routes and I wanted to organize them.

But here we’ll take a brief look and see what the study entails, while also adding some more context if needed.

Study Outline

This study in question is a rather small one, utilizing patients who were part of another study on the BCG vaccine as noted in the prior article. Remember that this study, the Melbourne Infant Study: BCG for Allergy and Infection Reduction (MIS BAIR), was conducted in neonates in which the BCG vaccine, a live, attenuated vaccine against tuberculosis, was given to one group of children while another was given placebo. The children were then tracked for a given time period to see the rates of secondary infections, allergies, and asthma. It essentially acted as a more tame version of assessing “all-cause mortality reductions” from other vaccines.

Nearly 2/3 of the children enrolled in the COVID vaccine/cytokine study were in the placebo group. Again, the nature of this point is not clear to me. However, given that we are examining all of these vaccination procedures from the lens that they may influence immune responses down the line, this is something to at least think about when interpreting this information.

The authors do make a note in which separating out BCG recipients from BCG non-recipients did not appear to result in greater differences in results:

A sensitivity analysis of only participants who did not receive BCG vaccination in MIS BAIR indicated that BCG status had a negligible or no effect on the reported effect of BNT162b2 vaccination on cytokine responses (Supplementary Figure S3).

Children who were assessed for cytokine responses post-vaccination were administered the Pfizer/BioNTech vaccine, being provided 2 doses at 8 weeks apart.

Because no control group was used as it was deemed “unethical” to not vaccinate children against COVID the children were used as their own control, with blood samples taken the day prior to or the day of the first vaccination (V1). A second sample was then taken around 4 weeks after the second dose (V2+28). Children were then also given the option to provide an additional blood sample 6 months later (V2 + 182).

However, attrition seemed high relative to the 6-month follow-up, with the initial 29 children included in the study dropping down to 8 by the V2 + 182 optional sample collection timepoint.

Also, bear in mind that the caption for Supplementary Figure S3 notes that the heatmap constructed for BCG non-recipients comprised 25 participants. If following the numbers, this seems to suggest that only 4 of the included participants received the BCG vaccine.2

Blood samples were then challenged with different antigens/pathogens of either viral or bacterial origin. For bacteria, nearly all bacterial strains were heat-killed bacteria aside from BCG which, again, is a live, attenuated bacterial strain that causes tuberculosis.

For SARS-COV2 both inactivated virus (iSARS) as well as viral antigens were used, including the nucleocapsid protein (NCP).

In regards to other “viral” agents the story is a little bit more complicated. Note that no inactivated viruses were used for the “virus” part of the study. In actuality, the only virus that was used was a surface antigen derived from Hepatitis B. The other two agents are toll-like receptor agonists that are intended to mimic a viral infection, possibly by way of mimicking viral genetic material by way of sharing homology to nucleotides.

For instance, Resiquimod, or R484 is a TLR-7/8 agonist with a ring structure that mimics purines:

Resiquimod appears to be a strong antiviral agent, as its structure is similar to RNA molecules and can induce strong inflammatory responses.

Poly(I:C) is also a toll-like receptor agonist for TLR-3, and its structure mimics that of double-stranded RNA as it is comprised of two chains, with one of Inosine residues and the other of Cytosine residues:

This is important to note because the mRNA vaccines contain N-methylated pseudouridine along with other alterations which make the mRNA undetectable to the immune system. It’s been suggested that the mRNA vaccines reduce toll-like receptor responses, and it may be due to the fact that they go unrecognized.

Now, that being said, the problem is rationalizing whether any weakened response to TLR agonists is due to TLR inhibition of some sort, or due to lack of training of the immune system when it comes to recognition of exogenous RNA. Again, remember that the intent here is to not look at this study alone, but to look at it within the context of trained immunity as a general concept.

Note that this study never uses any actual attenuated or inactivated viral agents aside from SARS, so it’s not really an examination of viral infections but mere proxies by way of exposing blood to a viral antigen or simulacrums of viral genetic material.

Results

With everything said, the results are rather interesting. Across all cytokine measures there appeared to be a supposedly dampened response to bacterial and “viral” agents in children 4 weeks post-vaccination relative to their starting measures.

This can be seen in the heatmaps. Others have shown the cytokine graphs but I think the heatmaps organize things a bit better for assessments.

Heatmaps are more qualitative in their presentation. For this heatmap, agents are shown in rows with corresponding cytokine responses shown in columns labeled on the bottom of the heatmap. The top label denotes cytokines related to innate, adaptive, or mixed immune responses. Different cytokine responses relative to the initial timepoint is color-coded, with more red boxes suggesting a stronger response relative to baseline. More blue colors are associated with a weaker response. A white box notes a possibly minimal change in the cytokine relative to baseline.

Be careful of the numbers within each box, as the numbers are associated with p-values and not the actual heatmap value. Asterisks within each box notes statistical significance and to what degree (i.e. one asterisk is a p-value < .05, two is p-value < .01, etc.).

In a general sense, you want to look for “redder is better” and “bluer is…” I don’t have a rhyme for bluer that is associated with “worse”, but note that more blue is suggestive of a weaker cytokine response relative to baseline. The measures are based on differences between baseline and post-vaccination responses. Note that the values are logarithmic, and so every increase in scale is by a factor of 10 (i.e. a log value of 2 is 10^2 or 100 magnitude difference, not 20).

Across the board what’s obvious is that responses to SARS-COV2 (the COVID rows) are stronger relative to baseline at 4 weeks post-vaccination aside from responses to the nucleocapsid protein. However, for all other agents the response appears to be mixed-reduced overall as noted by all of the blue. Note that the difference didn’t appear statistically significant aside from clear examples such as IFN-gamma, MCP-1, and a few interleukins (6, 8, and 15 in particular).

The researchers make the following comments:

Following heterologous bacterial, fungal and viral/TLR agonists stimulation, there was a general decrease in cytokine and chemokine responses in children between V1 and V2 + 28. The largest decreases were seen for IFN-γ and MCP-1 (Figures 2, 3A-C). IL-6, IL-15, IL-17 also decreased between V1 and V2 + 28 following stimulation with BCG, H. influenzae, S. aureus, hepatitis B antigen, poly(I:C), and R848 (Figure 3B). L. monocytogenes stimulation induced IL-15, TNF-α and IP-10 decreases between V1 and V2 + 28 (Figure 3C). IL-8 responses also decreased between V1 and V2 + 28 following H. influenzae and S. aureus stimulation. RANTES was the only analyte that increased in response to heterologous stimulants (L. monocytogenes and C. albicans) between V1 and V2 + 28.

Again, this may seem rather alarming, and in some sense may be suggestive of reduced immune function post-vaccination. However, note that this study is examining cytokine responses rather than immune responses. It’s more that the immunological responses are inferred based on the cytokines, although it doesn’t tell us much of what is actually happening.

It’s worth considering whether the recent presentation of spike may show a stronger response towards spike because the body has been alerted to look out for this antigen in particular. In that regard, immune cells and signaling responses may be biased towards a response that favors spike. This may account for why TLR agonists don’t appear to show a strong response because the immune cells may have not have been trained to survey for that factor in particular.

That being said, the last comment would require an assessment of each child’s prior history to understand the influence of prior infections on overall responses. Keep in mind that any child that tested positive for the NCP was excluded from analysis, including those who tested positive in between the V2+28 and V2+182 timepoints.

Note that the study is a comparative study as well. It doesn’t tell us much about what the reduced cytokine response amounts to in actual individuals since no quantitative measures are provided. It’s possible that the reduced response is still enough to combat pathogens, or that children in general may not produce strong responses to certain antigens. As an example, what would the proper response to Hep B antigen presentation be in children, or for other viral/bacterial antigens?

One positive for this study is that children were matched to their baseline values, but that doesn’t help much when their overall values are jumbled together with the other children, so we don’t know the degree of variability among each child in their responses.

The 6-month follow up is a bit interesting in some aspects. Note that this follow-up only included 8 children relative to the 29 at the 4 week mark, however it appears that the researchers took this into account.

The top heatmap shows differences in cytokine responses 6 months out from the second vaccination (V2+182) when compared to baseline. The bottom heatmap shows difference between the two timepoints post-vaccination (V2+182 compared to V2+28).

There’s a bit going on here. The best way to parse the two heatmaps is to understand what they are conveying. Essentially, the top heatmap could be seen as a “return to baseline” map. It allows you to see whether cytokine responses normalize 6 months out from vaccination, or whether immunological changes persist and to what degree the changes have manifested.

In contrast, the bottom heatmap is more of a measure of relativism in regards to whether children improved or worsened in the following months. For instance, any blue would suggest that the cytokine response towards that agent may have worsened over time whereas any red may show improvement over time.

A good rationalization would be the response to S1 and S2 of the spike. Note that, overall, the cytokine response to spike is elevated relative to baseline even 6 months post-vaccination. However, when looking at the bottom heatmap the two rows for S1 and S2 appear blue, suggesting that the cytokine response seems to attenuate over time. So even though the response is stronger post-vaccination (as would be expected), it still declines the further out from vaccination one goes (allegedly).

In this case, a discrepancy between bacterial and viral agents appears to have occurred, such that cytokine responses to bacterial agents seems to have “normalized” at the 6 month post-vaccination mark, as noted by the white boxes.

In contrast, the “viral” rows appear blue even at the 6-month mark, noted reduced cytokine responses to these agents months out from vaccination. When compared to the bottom heatmap, note that the values for HepB antigen and PolyIC are blue, suggesting that the response worsened the further out from vaccination one goes (using only two timepoints).

Now, the obvious question is why such a discrepancy is occurring between bacterial and viral agents. The obvious suggestion is that differences in presentation of pathogens may be at play as was noted in the previous article, such that whole bacterial agents as well as the live, attenuated BCG vaccine may provide a more well-rounded cytokine response in contrast to the possibly more selective nature of the HepB antigen and the PolyIC agent. However, given the limitations of this study this is mere speculation. Further studies with different agents may provide a better window into what exactly is going on here.

What does this all mean?

The burning question is whether these results relate to anything meaningful in the real world.

Unfortunately, to that the answer falls along the lines of either “I don’t know” or “it depends”.

Because this study lacked any controls we can’t say for certain whether these results are related to the vaccines or whether these results may be due to seasonal changes in virus and bacteria exposure.

Brian Mowrey makes this remark in his article about this study:

Great, Vaccine Doom Confirmed, except for the thing that I find unhelpful about all these studies — there is no unvaccinated control group. It goes without saying that had there been such a control group, with kids who do not receive the vaccine but are sampled at similar time-points somehow producing similar results, we would need to look to a different explanation (e.g., local seasonal patterns in viruses and bacteria). I will never be satisfied by post-vaccine group biological response studies that leave out controls (and cannot help but think the intention is to get random assay noise past peer review).

Unglossed

Update to the case against bacterial co-infection

I have made a slight addition to my prior post regarding the theory that “Covid-19” and deaths attributed to the same were secretly all caused by maltreatment of bacterial pneumonia (as recently litigated by Neil, et al.). These additions regard the more niche aspect of the epidemiological properties of the virus and the claims (made in Neil, et al. but …

Read more

3 years ago · 19 likes · 7 comments · Brian Mowrey

Remember that the children in these studies are not isolated during the time between vaccinations and post-vaccinations, and so these children have likely come across various viral and bacterial agents outside of SARS-COV2, which may have influenced their immune responses, especially given that these children are of school age. Although the researchers controlled for SARS-COV2 positivity by excluding children who tested positive for the NSP, the same can’t be said for other pathogens.

And so the study itself becomes paradoxical, whereby the assumption that the mRNA vaccines may alter children’s immune responses has to be considered within the context that other agents may also alter immune responses as well.

So is all of this due to the vaccine in particular, due to circulating pathogens, or due to other circumstances not considered in this study?

There’s also the fact that cytokine responses infer immune responses, but they don’t tell us exactly what else is going on. Note that the adenoviral-based vaccine study3 cited by Noé, et al. looks at monocyte “behavior” as well as cytokine responses, providing a better window into what exactly is going on.

A more detailed assessment would look at each individual cytokine, in particular the ones that showed the greatest variability, and determine what role those cytokines play and what may lead to their reduced release. MCP-1, which seems to be reduced even at 6 months post-vaccination, is an agent that attracts other immune cells and is predominately released by monocytes and macrophages, and may be something worth investigating.

Overall, the missing factor is determining what all of this means in the grand scheme of things.

On one hand, these results may tie into increased infection in children in recent years. However, it doesn’t quite explain whether children should recover or if they should eventually succumb to their illnesses.

This is one of the problems with the narrative of COVAIDS or VAIDS, as it essentially becomes self-contradictory. Consider that AIDS, if left untreated, results in further immune deficiency and worse outcomes for even common pathogens. Most AIDS patients appear to die from secondary infections.

Invocation of COVAIDS or VAIDS should, if the model is being consistent, suggest that people are getting more sick and would require hospitalization or may result in death, and this does not appear to be the case.

Any severe adverse reaction or death post-vaccination doesn’t appear to be related to secondary infections, although the role of HHV reactivation is something worth considering for some individuals.

But even with that being said, the reactivation of VCV for most individuals appeared relatively transient and cleared up without any treatment for most people, again suggesting that there’s more to the immune deficiency than perpetual VAIDS, otherwise we should not expect resolution of VCV reactivation or other illnesses.

We don’t know whether the children included in this study reported various illnesses during the study period, and no reported cases of hospitalizations or exclusions due to death were reported, so once again all of these hypotheticals are still up in the air.

In a more optimistic sense, I’m inclined to consider that people may be more susceptible to infections within the periods following vaccinations, with infections eventually resulting in attenuated of these deficiencies, but again studies would need to further examine what is going on.

Remember that our immune systems are a lot more complex than we may think. There’s still a lot that has not yet been discovered. Consider that the concept of “an innate immune system” seems to be incorrect based on recent findings, and so even a long-held belief in immunology is likely to need some major correcting.

In any case, further studies and real-world corroborations would help discern the degree of meaningfulness from this study.

Substack is my main source of income and all support helps to support me in my daily life. If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

As the war over the COVID vaccines rage on, and as fear over rising COVID cases make their way into the media, a push for further COVID vaccination looms with even possible vaccine mandates making a return.

As I stated previously, at this point it’s not so much that people may dive right into getting more boosters, but rather at this point most people may just be done with the whole performative charade overall and would rather just move on with life.

Nonetheless, there is still a lot left to be elucidated when it comes to these vaccines, including the extent of their possible harmfulness.

Over the past week several people have covered a recent study1 which seems to highlight a possible concern with these mRNA vaccines, in that they may possibly weaken the immune system of vaccinees.

This comes after a preprint was published in March 20232 which seems to parallel the results seen in this recent study.

In short, there’s a growing body of work that suggests that vaccines and infections can influence how we respond to future infections. Although it’s been previously thought that the innate immune system is static (i.e. it cannot be modified), the literature does seem to suggest that the innate immune system itself can be altered by way of various pathogens.

Some of this may be direct depletion of immune cells, such as what appears to be the case in measles where immune depletion is seen months to days after an infection and may contribute to non-measles related mortalities.3

And indeed, lymphocytopenia from SARS-COV2 infection also suggests a possible way in which secondary infections may contribute to mortality. A recent study published in Cell4 also notes the possibility of epigenetic changes to innate immunity after severe COVID infections, which may be related to Long COVID. However, note that in this study this correlation seems to be related to persistent cytokine production in acute COVID infection and possible alterations in immune responses due to these cytokines.

I haven’t read this study yet so take these assertions with a good deal of skepticism. Nonetheless, what this tells us is that the immune system seems to be in a constant state of ebb and flow, being influenced by the insults we throw at it. It’s a lot more complex than expecting an all-around robust immune response to any pathogen, and instead infers that the immune system may direct, or possibly pick-and-choose how to go about dealing with these foreign substances.

Consider that, in contrast to these mRNA findings, studies seem to suggest that the adenoviral vector vaccines seem to enhance cytokine responses, suggesting a possible secondary immunity boost in these vaccines.5,6 There also seemed to be some remarks suggesting a reduction in all-cause mortality in those who were given the adenoviral vector vaccines, although I haven’t looked into these assertions.

These effects are referred to as “non-specific” effects, as they aren’t effects directly tied to the pathogen in question (SARS-COV2), but are nonetheless influenced by vaccination against said pathogen.

So this raises a question of why this discrepancy is occurring. On the surface, it could be related to demographic differences (the current study occurred in children in contrast to the adults in the mRNA preprint and adenoviral study).

The LNPs and pseudouridine nature of the mRNA vaccines may circumvent immune responses, and therefore lead to a reduced inflammatory response relative to an infection, although the adjuvant-nature of the LNPs seem to also be highly inflammatory, making the scenario more complex and requiring contextualization to determine which inflammatory biomarkers may be up or downregulated after vaccination relative to infection.

However, there’s a large possibility that this difference in immune responses is also due to the nature of the adenoviral vector vaccines, which inherently utilizes a different virus and requires transcription and translation in host cells. This is a more complex process that may mimic an active viral infection, which could induce a more robust inflammatory response as the other genes within the adenoviral vaccines, as well as the viral vector itself, are likely to both be immunogenic.7

So there’s a possibility that either the mRNA vaccines are immune weakening, or it’s quite possible that they are immune “lazying”, such that their spike presentation doesn’t serve as a similar parallel to an infection, and therefore the immune system doesn’t need to work as much.

This was remarked on in Dr. Maryanne Demasi’s Substack where she provides quotes from epidemiologist/professor Dr. Christine Stabell Benn, suggesting that inactivated virus-based vaccines may show greater all-cause mortality relative to live, attenuated vaccines, again likely emphasizing the point that the immune system likely has to work in order to stay strong.

Maryanne Demasi, reports

New research shows mRNA jabs could weaken immune responses

Last week, a new peer-reviewed paper published in Frontiers in Immunology has sparked concern over whether mRNA shots could be weakening a person’s immune response. The small study involved 29 children aged 5-11 years. Blood samples were taken from the children before and 28 days after a second dose of Pfizer’s mRNA vaccine. Samples from eight children …

Read more

3 years ago · 104 likes · 11 comments · Maryanne Demasi, PhD

“We found in our work that three months after subjects received the DTP vaccine, they showed lower immune responses in vitro to other infectious stimuli,” said Stabell Benn.

“Essentially, the immune cells become lazy, and they simply don't respond as vigorously when they are challenged with an infectious agent,” she added.

The opposite was true when “live” vaccines were administered to people, such as the BCG (tuberculosis) vaccine.

“After BCG vaccination, immune cells would react more actively in response to other bacterial stimuli by reprogramming cells in the bone marrow to spit out more active innate immune cells,” said Stabell Benn.

DTP is a combination vaccine which targets diphtheria, tetanus, and pertussis, and generally includes the toxoids (toxic agents) of diphtheria and tetanus while using either a killed bacterial or the antigens from the bacteria that causes pertussis.

In contrast, BCG is a live, attenuated vaccine of Mycobacterium bovis, the bacterial agent in tuberculosis.

Because this vaccine has an active, albeit weakened, strain of the bacteria it seems to produce a broader immune response relative to pure antigen presentation given its ability to still be infectious. Several bits of literature have come out suggesting possible heterologous effects of BCG vaccination in immunity.8

Interestingly, a study from 20219 published in Nature looked at immune profiles in those given the inactivated SARS-COV2 vaccine Vero Cell. I haven’t looked at the study in detail, but cursory examinations seem to suggest that the inactivated viral vaccine led to a response “similar to an infection”, which appeared to include signs of immune deficiency:

Moreover, the gene set positively contributing to MVS scores, also known to be associated with severe symptom development, was highly expressed in monocytes. Type I interferon (IFN-α/β) responses, supposedly beneficial against COVID-19, were downregulated after vaccination. In addition, the negative MVS genes were highly expressed in lymphocytes (T, B, and NK cells), yet showed reduced expression after vaccination. Together, these data suggested that after vaccination, at least by day 28, other than generation of neutralizing antibodies, people’s immune systems, including those of lymphocytes and monocytes, were perhaps in a more vulnerable state.

So again, there’s a curious question of whether the mRNA platform itself carries a risk of immune deficiency, or if the immune system isn’t made to respond to simulacrums, and instead operates better when challenged.

In the case of the COVID vaccines there doesn’t appear to be any attenuated viruses in use, although the Novavax platform may provide some insights into these immune responses. That is, if Novavax appears to show an immunological response similar to the mRNA and inactivated viruses then it may suggest that some form of an active infection may be needed to induce broader immune responses.

Thinking in context

I will save the assessment for the Noé, et al. study for another time. In the meantime, note that, Aside from a small sample size, the study utilized children that were enrolled into a BCG vaccine trial in which non-specific effects of infant BCG vaccination was measured. It appears that many of the children enrolled into the Noé, et al. were children who were not given a BCG vaccination in the BCG study:

Of the 47 children who provided a blood sample at V1, 21 were female and 32 did not receive BCG in the MIS BAIR trial.

I’m not sure to what degree this point is relevant when it comes to the Noé, et al. study, but given that the entire point of this article is to emphasize that prior vaccinations and infections may mold our future immune responses, then it may be worth considering whether BCG vaccination may have had any effect on the results of this trial. Keep in mind that lack of vaccination in the MIS BAIR trial does not mean these children never received BCG at some future point in time.

Note that this trial itself also doesn’t provide an accurate measure of future infections. That is, it utilized isolated cells and determined their response to antigens or heat-killed bacteria, and so the study itself doesn’t mimic a proper infection. It’s also worth considering, given the naïve history of these children’s immune profiles, if the responses in these studies are due to lack of prior exposure to these pathogens given that the study would inherently show a bias towards SARS-COV2 responses if exposed to SARS-COV2 antigens.

It’s always important to assess information from the perspective of figuring out what exactly the study would mean in a general sense. Consider what information you would need to draw conclusions of whether the mRNA vaccines are causing immune deficiencies, or what evidence would refute this argument.

A good example would be to compare infection rates in this vaccine group relative to a non-vaccinated group and measure immune profiles post-secondary infections. Unfortunately, since this study was conducted in Australia there was no viable control group since it was considered “unethical” to not vaccinate any children:

Limitations include the inability to include an unvaccinated control group due to the ATAGI recommendation for all children aged 5 to 11 years to receive the BNT162b2 vaccine. It was unethical to randomise children into an unvaccinated, placebo or delayed vaccination group, given that ATAGI recommended the BNT162b2 vaccine for the age group of interest and that Melbourne was experiencing a surge in COVID-19 cases in the community during the study period.

It would be critical information to figure out whether children experience increased rates of infection, or if the immune system is more malleable and not “fixed” after COVID vaccination.

Put another way, are children vulnerable to more infections after vaccination, but then “recover” their immunity afterwards? Again, this is something that would need to be studied.

All of this does, however, raise a question of whether the increase in childhood infections are due to the immune deficiency from the vaccines, due to immunity debt, or due to other circumstances. In general, it seems that the body needs to be challenged in order to become more resilient, and it’s apparent that everything that has gone on the past few years have worked against strengthening our immune systems.

Our immune system is a lot more complex than we make it out to be, and even now more information comes to light about facets that we did not know about, which is again why more research and better studies are always needed in order to gain better context.

Note: It is, however, interesting to think about these immune deficiencies within the context of HHV reactivation, which I have covered previously. It’d be interesting to consider the course of HHV reactivation and attenuation within the context of these possible immune deficiencies:

Substack is my main source of income and all support helps to support me in my daily life. If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

Prior posts for those interested:

Using the prior information regarding HHV reactivation this post is intended to provide a broad summary and some questions worth asking in regards to the link between HHV reactivation and some of the signs/symptoms seen with SARS-COV2 and the COVID vaccines. A lot of this information may appear redundant, but I find that it helps to at least organize my thoughts.

The prior posts examining HHV reactivation aren’t intended to provide a clear explanation for everything going on, but rather something worth considering as a possible explanation for some of these instances of severe SARS-COV2 and vaccine adverse reactions.

Consider the fact that HHV reactivation has been closely associated with chronic fatigue syndrome and other post-viral syndromes. In the era of COVID it may not be that Long COVID is due entirely to SARS-COV2, but may be due in part to HHV-reactivation. However, in a SARS-COV2 only era of medicine many clinicians may not consider this possibility, in which case many reports of Long COVID and severe COVID illness may not take into account the role that HHV reactivation plays in outcomes.

While people reported cutaneous symptoms of VZV reactivation following COVID vaccination, there were also many reports of people feeling fatigued, having headaches, and other neurological symptoms that may have gone away in due time. Albeit transient for some individuals, this itself raises a question as to whether these instances may not be completely spike or vaccine-related, but rather signs of HHV reactivation as well, which may not present with rashes or skin lesions but otherwise present as alterations in mental state.

It’s also important to note that HHV reactivation can be caused by a host of factors, and has been reported several times within the literature to be associated with other vaccines, and even severe illness of other sorts such as sepsis. Even hospitalization itself can lead to an increased risk of HHV viremia.

Given this fact there’s a clear question of whether the HHV reactivation seen following SARS-COV2 illness and vaccination are occurring at higher rates relative to reports for other illnesses and vaccines.

The explanation for this possibility of higher prevalence in the COVID era hasn’t been fully elucidated. As mentioned previously, some of the explanations provided include some of the following:

• SARS-COV2’s possible lymphotropism may lead to lymphocyte exhaustion, allowing for HHVs to reactivate unabated. In fact, the lymphotropism shown by some HHVs may suggest that a synergistic mechanism of lymphocyte exhaustion may be occurring for some cases of severe SARS-COV2 infections.

• There’s been some suggestions that synergism between certain HHVs and SARS-COV2 may be occurring as well. In this case, gene expression for ACEII and other surface proteins may be enhanced by HHVs which may allow for greater viral entry of SARS-COV2.

• In some instances of SARS-COV2 infection and vaccination autoantibodies against antimicrobial agents such as interferons may dampen the innate immune repose, thus also providing a window of opportunity for infection.

• A SARS-COV2 infection, as well as vaccination, may also direct the immune response to target the virus and spike protein, possibly leaving another window of opportunity for HHV reactivation. Note that this argument is not an OAS argument.

• Given stress’ propensity to induce HSV reactivation, it’s quite possible that HHV reactivation is more likely during the COVID era due to the widespread stress and anxiety many people experienced due to the lockdowns and mandates. This aspect doesn’t appear to be explored, although I wouldn’t be surprised if there was some association. If evidence arises, this again would suggest a serious flaw in the lockdown/mandates being enforced.

• COVID hospital protocols have been under serious scrutiny as being both ineffective and possibly even being deadly. Given the increased risk of HHV reactivation in a hospital setting there’s a question of whether COVID hospital protocols may have been associated with increased HHV reactivation. Consider that corticosteroid use may be associated with HHV reactivation. Widespread use of Dexamethasone may have played some part in HHV reactivation. However, the association between corticosteroid use and HHV reactivation has remained controversial. Also, note that the clear association between HHV reactivation and worse outcomes has not been clearly established.

In regards to the vaccines several of the vaccine platforms appear to show evidence of HHV reactivation. Again, the question remains which ones show greater prevalence and why. The evidence so far suggests a bias towards the mRNA platforms, especially with Pfizer/BioNTech. However, this comes with the caveat that Pfizer/BioNTech’s vaccine was the most widely available vaccine for many countries, and so higher rates of HHV reactivation following the use of this vaccine may boil down to a numbers game.

Nonetheless, the explanation here may lie in the cytotoxicity of the spike as nearly all platforms are intended to induce spike presentation in some way. There’s also the fact that directed immune responses towards the vaccines may also leave openings for HHV reactivation.

However, there’s also a possibility that adjuvants and other immunomodulating agents may alter the native immune response, thus allowing the a window for reactivation.

The latter doesn’t appeared to be explored, and the former two arguments are in-line with what may be happening with SARS-COV2 infections, providing a possible overlap in models.

As of now the reasons for the prevalence of myocarditis following SARS-COV2 infection and vaccination are still up in the air. However, as mentioned in previous articles, viral myocarditis is considered to be one of the main causes of cardiovascular events and even sudden cardiac death, given that some endomyocardial biopsies in those with heart failure and other heart issues tend to show the presence of HHV DNA.

Keep in mind that HHV detection in some of these cases may be due to the bystander effect, in which case the compromised state of the heart allows for HHV reactivation rather than the other way around (i.e. that HHV reactivation leads to heart damage and failure).

Nonetheless, the role of HHV reactivation within the heart of some SARS-COV2 and vaccine patients is worth considering, and may provide another overlooked model as many clinicians or pathologists may focus on spike or SARS-COV2-derived heart damage.

Consider, overall, that many of the signs/symptoms of SARS-COV2 infections such as myocarditis, neurological issues such as headaches and fatigue, Long COVID, and even some adverse reactions following COVID vaccination overlap with symptoms of HHV reactivation.

Unfortunately, reports continue to miss out on pertinent information. It may be worth it for researchers and clinicians to consider HHV reactivation in biopsies of myocarditis patients, as well as some post-mortem patients. Antibody titers against HHVs should also be considered for those who experience adverse reactions following COVID vaccination.

All of this may prove to amount to nothing in the end, but more answers and investigations is better than the limited number of investigations that are occurring right now.

A suggested article on the lack of key information:

Substack is my main source of income and all support helps to support me in my daily life. If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

Prior posts for those interested:

Following the prior posts this one will be shorter in nature (apologies for the rather long posts!). As has been discussed previously there is clear evidence of HHV reactivation in those who were infected with SARS-COV2 as well as in those who were vaccinated.

In these cases recognition of HHV reactivation, and usually VZV in particular, is done by way of looking for cutaneous signs/symptoms of reactivation. That is, a rash and blisters following vaccination is likely a presentation of VZV reactivation as herpes zoster (shingles).

However, not all HHV reactivations may represent with cutaneous symptoms. Remember the two cases reports from Bookhout, et al.1 in which two fatal cases of otherwise treatable HHV infections went unnoticed until too late, with one person not presenting with cutaneous symptoms until far too late into the disease while the other individual never presented with cutaneous symptoms. Therefore, cutaneous symptoms may not be the best method of discerning HHV reactivation, and certainly may prove deadly if not recognized by other means.

This is emphasized by the fact that cognitive impairment post-COVID and post-vaccination has been widely reported, as well as growing evidence and recognition of parallels between HHV reactivation and Long COVID.

With that in mind, the following is intended to introduce case reports in which neurological complications, predominately meningitis and encephalitis due to HHV reactivation, have been noted post-COVID vaccination, emphasizing the point that a lot of serious adverse events may be overlooked or unrecognized.

Encephalitis vs Meningitis

Before we begin, we should note that some of these case reports will either note encephalitis or meningitis in these individuals.

As the -itis suffix implies, both are diseases of inflammation, and in particular both note inflammation of the CNS. However, meningitis refers predominately to inflammation of the meninges, which are 3 layers of membranes that envelop the spinal chord and the skull (all recognized by the word mater).

In contrast, encephalitis refers to inflammation of the brain itself.2

Both forms of inflammation can be caused by infectious agents including viral agents such as HHVs which tend to show neurotropism.

The signs and symptoms for both encephalitis and meningitis overlap and may even appear flu-like, although more severe forms of inflammation may present more differently. One contrasting symptom is that meningitis may present as neck stiffness.

Some of the signs and symptoms for each inflammation can be seen below (both from the NIH website):

Encephalitis Signs/Symptoms

Meningitis Signs/Symptoms

Post-Vaccination Case reports

Again, there may be a bit of disorganization here, but when possible distinctions will be made for the type of vaccine, what dose, and strain of HHV if detected.

Encephalitis Post-Vaccination

One case report from Moslemi, et al.3 notes of a 27-year old man who awoke to sudden vomiting 3 days after receiving the first dose of the Oxford/AstraZeneca adenoviral vaccine. He began experiencing severe headaches and changes in mental faculties, eventually ending up in the ER after worsening symptoms. Preliminary diagnosis suggested possible encephalitis, and eventual suspicion of herpetic encephalitis led to the use of Acyclovir for the patient. Meanwhile, most lab tests appeared normal with no neurological deficits recognized.

The authors don’t appear to mention evidence of cutaneous symptoms.

CFS samples noted the presence of Herpes Simplex 1 viral DNA, confirming the suspicion of herpetic encephalitis. The patient was prescribed Acyclovir for 21 days, and although he didn’t make a full recovery by the time of discharge he showed visible improvements.

This is one of the first reported cases of possible HSV1 reactivation following COVID vaccination. As the authors imply, lack of treatment can become devastating for the patient. Unfortunately, the lack of evidence in the literature suggests that many clinicians may not be aware of considering this association, or how to treat such an event.

This appears to be one of the only cases of herpetic encephalitis following COVID vaccination, although there has been reported cases of encephalitis following vaccination that appear to be associated with other factors such as possible autoimmunity, suggesting that manifestation of encephalopathy may be due to other factors but relating to a commonality of the COVID vaccines.

Meningitis Post-Vaccination

Unlike herpetic encephalitis, there appears to be some evidence of meningitis associated with HHV reactivation following vaccination.

One of the first case reports recorded in the literature is from Maruki, et al.4 in which case a 71-year old woman with IgA nephritis began experiencing headaches the day after receiving the first dose of the Pfizer/BioNTech vaccine. She had a stiff neck although no neurological complications.

However, 5 days after her vaccination she began experiencing painful erythematous (red) patches, leading to a diagnosis of possible VZV-related meningitis which was confirmed with lesion sample testing and CSF PCR testing for VZV DNA.

• Although this patient presented with cutaneous signs of VZV reactivation, the presentation was localized and rather minimal, in which case such presentation may be easily missed. This patient was also recognized as being immunocompetent, and thus also raises a question of possible VZV-reactivation following a vaccination as this may imply a possible window of immune deficiency as has been suggested previously.

In one case report from Medhat, et al.5 a 46-year old woman presented to the clinic with 3 days of severe headaches which did not respond to treatments. The patient’s COVID vaccine history included prior vaccination with two doses of Sinopharm’s inactivated virus vaccines, along with a booster dose of Pfizer/BioNTech’s vaccine 3 weeks prior to the onset of the headaches.

The patient presented as hypotensive and with a low-grade fever, with the only other notable symptom being neck stiffness.

A lumbar puncture would later come back positive for VZV from PCR, suggesting VZV-related meningitis which was later confirmed with another VZV PCR test (not based on CSF).

The patient was administered many different medications, but the focus became Acyclovir after the positive PCR test leading to eventual full recovery.

• Although the authors suggest a possible vaccine-related case of VZV meningitis, note that the onset of the meningitis occurred weeks post-vaccination, and so some hesitancy may be warranted in making such an immediate conclusion. Also, note that this case occurred with the mRNA booster after inactivated virus vaccines, and so presents with an interesting case. Given that HHV reactivation has a higher prevalence with the Pfizer/BioNTech vaccine this may infer something related to this vaccine in particular that is worth considering, although this comes with the caveat that the Pfizer/BioNTech vaccine was administered at a much higher rate than the others.

A report from Buranasakda, et al.6 notes two cases in which VZV meningitis occurred within 10 days of receiving different COVID vaccines.

One patient, a 34-year old man with a history of being infected with VZV twice during childhood, presented with lesions along the left side of his waist 5 days after receiving the first dose of the inactivated virus vaccine from Sinovac. Nine days after vaccination the patient presented to the clinic with severe headaches. The patient would go on to present with a stiff neck along with more lesions along his back.

Eventual PCR tests would turn up positive for VZV, leading to a diagnosis of VZV meningitis. The patient was administered Acyclovir intravenously for 14 days and appeared to make a full recovery. The patient would later go on to receive AstraZeneca’s vaccine with no apparent evidence of an adverse event.

In contrast, the second case notes of a 32-year old man who began experiencing headaches 5 days after receiving the first dose of the AstraZeneca vaccine.

Upon initial presentation the patient did not have any skin lesions. A lumbar puncture was conducted on this patient as well.

Two days after admission the patient was reported has having lesions on his back, and CSF PCR would eventually come up positive for VZV, suggesting VZV meningitis. The patient was also placed on a 14-day regimen of Acyclovir.

In the end, the patient seemed to have full resolution of symptoms and went on to receive the second dose of the AstraZeneca vaccine one month later, noting a mild fever afterwards.

• Note the contrast in these two cases. Not only did these two patients receive different vaccines, but one presented with cutaneous symptoms prior to the onset of headaches while the other had headaches that preceded the skin lesions, again suggesting that some patients may not have recognizable lesions or ashes but an otherwise viral-related episode of meningitis.

  ---

Things to Consider

The reported cases of either meningitis or encephalitis relating to the COVID vaccines have so far been very limited. This may be due to underreporting or not contributing these events to vaccines. At the same time, like with all HHV reactivations, it’s important to consider that many factors can contribute to HHV reactivation, and so any reemergence of shingles may also be associated with some risk of meningitis or encephalitis. It’s quite possible that some of these events are coincidental.

With that being said, what’s also important within the context of the COVID vaccines is the fact that it seems rather evident that they contribute in some way to the ability for HHVs to become reactivated.

This may either be due to immunomodulatory properties of vaccines, or it could be due to factors related to the spike protein. Consider that prior evidence notes that COVID can lead to lymphocytopenia, and so lymphocyte exhaustion, as well as autoimmune responses towards antiviral interferons, may make HHV reactivation more easy relative to prior vaccines.

Therefore, the fact that cutaneous symptoms of HHV reactivation have occurred rather commonly should raise some critical concerns over whether these reactivations may be leading to other diseases. This is worth examining given that these brain inflammations may not present with cutaneous signs but may nonetheless prove deadly if not treated.

Overall, keep in mind that the intent of examining HHV-related adverse events is not to suggest that this is the main culprit for everything going on but something worth considering within the grand scheme of vaccine-related complications.

With that being said, consilience and further remarks will be saved for a future post.

Substack is my main source of income and all support helps to support me in my daily life. If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

Prior posts for those interested:

In lieu of the prior posts we can consider the effect of COVID vaccination on the uptick in HHV reactivation. As many of us are aware, it was rather common to see people report evidence of herpes zoster (shingles) following vaccination, and led to great attention over what this may mean.

Not much seems to have come from these initial reports, and so it’s quite possible that a lot of information has been taken for granted that would otherwise provide pertinent and relevant information for all of the adverse events seen, especially in assessing overlaps between Long COVID post-infection as well as “long vaccination”.

For instance, most reports on HHV reactivation have focused predominately on chickenpox/shingles, and so other HHVs have not been as well-examined. There’s also the fact that many of these reports were considered mild and transient, which may not bode well given the fact that many HHVs have been associated with cardiovascular issues such as myocarditis.

With all of this in mind we’ll take a look at a few case reports and literature reviews of HHV reactivation following COVID vaccination. Note that some of these case reports and studies will likely be included in various systematic and literature reviews. Also, once again, the focus here will unfortunately be more directed towards herpes zoster (shingles) and varicella zoster virus (chickenpox).

Things to consider- PR and PR-LE

Many of the HHVs present with cutaneous (skin) symptoms such as rashes, itchiness, and other sorts of symptoms. Most HHVs, such as HSV-1 and 2 and VZV present with blister-like rashes.

HHV-6 and HHV-7 can also present with cutaneous symptoms during reactivation, although in the case of these HHVs the skin rashes are a bit unique, with the presentation being labeled as pityriasis rosea1 (“scaly pink”). The rashes are more oval and larger in appearance, usually involving the trunk (torso) of the body. The rash can initially start as a small oval patch called a herald patch on the face or trunk of the body, although some instances of PR may not initially present with said patch.

Prior to the presentation of the herald patch symptoms of a sore throat, headache, fatigue, or fever may precede days before herald patch formation. Afterwards, the rash may extend the rest of a person’s trunk in a Christmas tree-like fashion, and so these cutaneous presentations have also been called a “Christmas tree rash”. Usually these rashes present for several weeks, and are usually considered non-severe in most cases and tend to fully resolve.

Although it’s been suggested that several cases of PR are related to HHV-6 and HHV-7 reactivation, the actual etiology can sometimes not be known due to limited investigations. For instance, PR may occur in response to certain drugs or vaccinations rather than due to HHV-6/HHV-7 reactivation.

In these cases of drug/vaccine-related PR, the skin rashes are termed pityriasis rosea-like eruptions (PR-LE). The cause for PR-LE is generally unknown, although it’s been proposed that the body’s hyperactivated response to a drug or vaccine may elicit the cutaneous symptoms.

It’s been suggested that PR and PR-LE rates increased since the onset of the pandemic, providing further association between HHV activation and SARS-COV2 (for both the virus and the vaccine).

Unlike PR, the rashes that present as PR-LE are itchy and appear darker/redder. Skin biopsies also tend to present with evidence of eosinophil infiltration.

Drago, et al.2 provides an outline distinguishing between PR and PR-LE.

One of the issues with differentiating between PR and PR-LE is due to the fact that many clinical assessments may not tests for the presence of HHV-6/HHV-7. Skin biopsies may not be taken from patients as well to confirm the presence of HHV or eosinophils.

One clear method of discerning between PR and PR-LE is the discontinuation of certain drugs to see if a patient’s skin clears of the itchy rashes, although this wouldn’t be possible in the case of vaccinations (you can’t “de-vaccinate” someone). Therefore, there tends not be clear evidence of HHV reactivation in some instances of PR or PR-LE events due to the lack of testing, with PR and PR-LE providing proximal associations that a viral reactivation is occurring.

There’s also the fact that PR and PR-LE may be mistaken for other skin conditions such as psoriasis, chickenpox/shingles, eczema, or others, and so clinicians may incorrectly conflate presentations of one HHV with either another HHV or some other etiological agent. Therefore, it’s quite possible that some reports of PR may be underreported due to mistaking them for other conditions.

All this to say that there’s likely to be some issues in data collection when it comes HHV reactivation following COVID vaccination. It’s possible that PR and PR-LE may have been overlooked or assumed to have been related to VZV and the presentation of shingles.

HHV Reactivation- Select Studies

Similar to the prior posts there’s a lot of case reports and studies to cover, so there may be a bit of disorganization going on. Also, remember that the literature is biased towards VZV reports.

Shafiee, et al.

3

This is one of the most recent systematic reviews on HHV reactivation, and in fact these posts on HHV were owed in part to this systematic review publication. After screening different studies the authors came across 80 studies worth reviewing (11 observational cohorts, 59 case reports , and 10 case report series).

Overall, evidence suggested an association between COVID vaccinations and VZV reactivation, with most of these episodes of reactivation being associated with the mRNA vaccines in particular. However, keep in mind that observational studies were likely designed with VZV assessments in mind, and so other HHVs may not have been examined. Interestingly, case reports/case series note a higher degree of HHV reactivation after the 1st dose relative to the 2nd or the booster.

Note that the case reports show an age-stratified presentation where VZV and CMV appeared in older patients (mean age ~55 and 60, respectively) whereas EBV, HSV, and HHV-6 reactivation appeared to occur in younger cohorts, although limited case reports may bias these results.

Most of the reports from this review were from 2022. Also, HHV-6 reactivation was at a scant 2 relative to the VZV reactivation which made up 70% of the case reports, which may either suggest that the prevalence of HHV-6 reactivation may be far fewer than other HHVs, or clinicians may not be aware of the need to assess for HHV-6/HHV-7. The lack of observational studies for other HHVs may suggest that researchers may have improperly focused on VZV, biasing the available information and creating a false impression of what HHVs to look out for.

Navarro-Bielsa, et al.

4

In contrast to Shafiee, et al. a review from Navarro-Bielsa, et al. examined reports provided to the European database of suspected adverse drug reactions (EudraVigilance), which seem to note a rather interesting collection of reports, specifically with respect to the extremely high case of HHV-6 following Pfizer/BioNTech’s vaccine:

Remember that VAERS and similar reporting systems may not differentiate between coincidental infections or infections related to vaccination. Therefore, it’s possible that many of these reports are tangential infections. The chart also doesn’t differentiate based upon other demographic data, including dosage. It’s possible that the high level of HHV-6 reports may be due to the approval period for Pfizer/BionNTech’s vaccine for children, such that most children may have been given Pfizer/BioNTech relative to other COVID vaccines, and so the timing may have been associated with childhood infection with HHV-6.

Now, that being said, if childhood infection were the explanation for the high HHV-6 infections we should at least expect a similar pattern to show up across all the other viruses if that were the case. The same can be said for the other vaccines, but again a smaller sample size of the other vaccines should be taken into account. Also, cutaneous presentation of VZV via chickenpox and roseola infantum via HHV-6 may suggest a difference in recognition of viral infection relative to EBV or CMV, which may be mistaken for common respiratory infections if they don’t present with cutaneous symptoms. One does have to consider the fact that the VZV and HHV-6 numbers are the same (not similar), and so VAERS-like reporting may have categorized these two together. VAERS-like reports are subjective to some degree, and so unless a full examination is conducted it’s hard to ascertain what these values mean.

The authors don’t provide an explanation for these figures, although the article is an interesting read for those who would like additional context for HHV reactivation.

Hertel, et al.

5

This review looked at over 1 million records within TriNetX’s global database for evidence of VZV reactivation following COVID vaccination. In this case, records were separated into two cohorts based upon vaccination records (Cohort I- vaccinated; Cohort II- unvaccinated). Patients were matched to remove confounders and were examined for rates of VZV reactivation between the two cohorts. Unfortunately, this study, like many others, focused solely on VZV reactivation.

The cohorts leaned older (mean age ~54) which would be expected. Patients within Cohort 1 were also predominately vaccinated with Pfizer/Moderna (~88%). Moderna vaccination was slightly below 10% and AstraZeneca around 1.5%. VZV reactivation was measured based upon reported cases within a 60-day time period following COVID vaccination. Information from the TriNetX database goes up until November 2021, so keep in mind that 2022 and 2023 are not accounted for in this data.

Given these parameters, there appeared to be evidently higher VZV reactivation among the COVID-vaccinated cohort relative to the unvaccinated cohort:

Unfortunately, the researchers don’t make mention of the prevalence of VZV reactivation with respect to vaccine dosage. They also don’t stratify the events relative to the vaccines as well. Also, the use of a 60-day window is rather broad and doesn’t provide insights into VZV reactivation relative to the vaccination period (i.e. are most of the reported VZV reactivations occurring days after vaccination or weeks/months afterwards?).

So overall, this study confirms the anecdotal/observational accounts of shingles and other markers for VZV reactivation, although it doesn’t add much additional context given the limitations of the study.

Pityriasis Rosea Post-Vaccination

Given that most investigations into HHV reactivation have focused on VZV in particular, I thought it pertinent to look for evidence of PR or PR-LE post-COVID vaccination and see what the literature mentions. Note that in many cases of PR or PR-LE a confirmation of HHV-6 or HHV-7 reactivation may not be made, and so it’s possible that the two (PR and PR-LE) may be used interchangeably.

Wong, et al.

6

This review from Wong, et al. examined case reports of PR following COVID infection and COVID vaccination. Unfortunately, as is expected, there doesn’t appear to be a distinction between PR and PR-LE based upon the case reports examined. Also, confirmation of HHV-6 and HHV-7 did not occur in most of these cases, leaving the cause of these cutaneous symptoms relatively unknown.

It’s worth noting that higher rates of PR/PR-LE occurred after the first dose of a COVID vaccine, with many of the reported cases occurring in those given Pfizer/BioNTech’s vaccine. Again, keep in mind a possible bias towards Pfizer/BioNTech and PR/PR-LE due to vaccination rates between the different vaccines.

In one review7 of cutaneous reactions in Turkish patients following COVID vaccination there appeared to be evidence of PR/PR-LE following the inactivated virus vaccine CoronaVac. Although the authors argue a higher rate of more severe cutaneous reactions following Pfizer/BioNTech, the evidence of PR/PR-LE with other vaccines suggest a possible overlap in causative agent.

Keep in mind that PR/PR-LE have been recognized following other types of vaccinations, and so all of these episodes may be tied to immunological responses to vaccination.

With that being said we’ll take a small look at case reports, although investigations may be rather limiting and may not provide much additional details. Because of this the scope of case reports will be limited.

For instance, one case report from Wang, et al.8 notes a 40-year old man who developed an extremely itchy skin rash 7 days after receiving the first dose of Moderna’s COVID vaccine. The rashes persisted the following days, becoming more oval in nature. No herald patch was recognized, although histopathological assessments of the rashes noted eosinophil infiltrates. The patient was noted to have had urticaria (hives) months prior.

The patient did not want further clinical assessments so no testing for viral agents was conducted, although the itchiness of the rashes along with the eosinophil infiltrate may be more suggestive of PR-LE rather than PR due to HHV-6/HHV-7 reactivation. Note that the eosinophil infiltrate that Wang, et al. identified was argued to be different than what has been recorded in the literature, and so this may not be a clear case of PR-LE.

Wang, et al. also include information for other case reports, although the diagnosis and treatment for PR/PR-LE is not provided in many of these case reports, again suggesting a lack of investigation for many of these case reports.

One early case report from Cohen, et al.9 notes of a 66-year old man who began developing a rash a week after his first dose of the Pfizer/BioNTech vaccine. Histopathological findings suggested PR, although no viral examination was conducted, and the patient seemed to have been prescribed triamcinolone for his itchiness.

A case report from Bin Rubaian, et al.10 notes of a 15-year old female who developed rashes 2 days following her second Pfizer/BioNTech dose. The rash would later spread throughout her body, leaving her self-conscious of the rashes.

A herald patch was noted, and the patient was diagnosed with PR and was prescribed Acyclovir (antiviral) for one week. The rashes stopped appearing following the Acyclovir treatment. Although no viral confirmation was conducted, the use of the antiviral Acyclovir and the reduction in rash formation may be suggestive of HHV-6/HHV-7 reactivation.

One atypical case report from Pedrazini, M. C., & da Silva, M. H.11 notes of a 53-year old woman who received two doses of the Oxford/AstraZeneca vaccine and eventual presented with a unique case of rashes.

The patient was described has having autoimmune disease via Hashimoto’s Thyroiditis prior to vaccination. Nearly two weeks after the second dose of the COVID vaccine she developed rashes on her right thigh which were mildly itchy. she attempted to treat the rash with an antifungal cream.

After 8 days the lesion grew along with other lesions located on the patient’s calf, buttocks, and thigh. A dermatologist, along with an infectious disease specialist, would later diagnose the patient with PR, and prescribed her antiseptic medications along with L-Lysine supplementation.

In this case, the typical rashes seen with PR/PR-LE were not present, with the cutaneous presentation involving various lesions relegated to the lower extremities of the body instead of the typical presentation on the torso of patients.

Although atypical in nature, the authors don’t provide any information on histopathological results, and so it’s curious what measures were used to come to the diagnosis of PR. Personally, I also couldn’t discern the supposed herald patch that is pointed out in Figure 1 so I’m a bit hesitant with this diagnosis.

That being said, it’s worth considering that PR/PR-LE may not always present in a similar fashion as what’s reported in the literature. This case also again emphasizes the fact that PR/PR-LE may occur with different vaccines.

For this atypical presentation the authors make the following remarks:

Diagnosis of typical PR, with Christmas tree‐shaped truncal involvement, is not difficult for doctors like dermatologists or general pediatrician however, its atypical presentations can be challenging even for these professionals. ¹³ In the typical form diagnostic doubts hardly arise but, as 20% of the cases present atypically, this can favor unnecessary procedures and drug prescriptions. ³⁴ Although it usually demonstrates a truncal predilection, this presentation may be absent in some patients who instead exhibit atypical features and distributions such as only lesions located in the extremities, ¹² as seen in this case report. The fact that PR is also confused with other pathologies such as psoriasis, syphilis, allergic dermatoses and fungi ³⁵ would justify the use of cream with ketoconazole and associations by the patient when the herald patch appeared.

Regarding the fact that the “mother patch” appeared soon after one of the doses of Oxford‐AstraZeneca, there are other reports described of PR after other vaccine schedules, for example, against smallpox, tuberculosis, influenza, papillomavirus, poliomyelitis, tetanus, pneumococcus, triple viral (diphtheria‐pertussis‐tetanus), hepatitis B and yellow fever. ¹¹ A report issued by the UK in June 2021 reports 52 cases of PR after Oxford‐AstraZeneca vaccination in the first half of the year but does not give details of whether the reactions were after the first or second dose of the vaccine. ¹⁰ Other anti‐SARS‐CoV‐2 vaccines also had PR as an adverse reaction ²⁸ , ²⁹ , ³⁰ , ³¹ with the manifestation occurring after the first dose, ²⁸ or after the second dose ²⁸ , ³⁰ , ³¹ and in some patients, the medallion (herald patch) and some lesions, occur after the first dose with exacerbation after the second dose. ²⁹ , ³¹

Overall, these case reports note of a phenomenon that has been well-recognized based upon anecdotal evidence. That is, it’s been rather evident that shingles and other cutaneous symptoms have developed in some people post-COVID vaccination.

The question remains to what degree many of these presentations are owed to HHV reactivation, or whether some of the symptoms, as in the case of PR-LE, are due to other factors such as an immunological response to the vaccines that manifest as lesions or rashes.

And even as many pieces of literature come out recognizing this association between COVID vaccination and possible HHV reactivation there still appears to be a lack of investigations that provide deeper insights. Consider that most reports on PR/PR-LE don’t make mention of HHV-6/HHV-7 reactivation, which would be a critical diagnosis to uncover as it would suggest a broader phenomenon of HHV reactivation.

So the degree of HHV reactivation is still relatively unknow. More importantly, cutaneous symptoms are not the only indication that HHV reactivation may be occurring. As noted in the case report from Bookhout, et al.12 from the first report some episodes of HHV reactivation may not be associated with cutaneous presentations, and therefore may go unrecognized until a possible fata incident may occur, such as may be the case for meningitis caused by HHV reactivation.

This will be covered within the next post, along with some attempts at consilience and rationalization of the evidence shown.

Substack is my main source of income and all support helps to support me in my daily life. If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

Before reading this post please refer to the prior one which looked a bit into human herpesviruses (HHV) in particular.

This post will look at some of the literature on COVID infections and HHV reactivation in order to emphasize the fact that there’s likely something more than a SARS-COV2 modality of myocarditis and other adverse events we are seeing.

One obvious overlap is the similarities between Long COVID and chronic fatigue syndrome- a syndrome which seems to be closely tied to HHV infection or reactivation.

This is why remarks that Long COVID doesn’t exist are rather dangerous, and in some ways come from a place of ignorance or denial in order to create a false presentation of what’s going on. Because post-viral syndromes has always been around one cannot immediately infer that Long COVID doesn’t exist for the sake of creating false narratives.

However, given a lot of the information that has come out it’s likely that symptoms of Long COVID may not be due directly to the virus or the vaccine, but possibly due in part to reactivation of latent HHV which may be brought on by an infection or vaccination. Again, remember that the literature is growing in evidence of HHV and other lifelong, debilitating illnesses.

And as many people discuss the possible neurotropic nature of SARS-COV2 consider that many HHVs are neurotropic themselves and are related to various cases of encephalitis and cognitive decline, with the area being most investigated being a possible link between Alzheimer’s and HHV, as mentioned in the previous article.

The studies included here are ones that I came across and serve as a literature review this available evidence.

COVID and HHV Reactivation

Remember that many factors can lead to HHV reactivation. Even stress can induce the reactivation of herpes simplex viruses, and there’s been an association between sepsis patients and HHV reactivation.1 It seems that hospitalization of any sort is associated with HHV reactivation, although the link between the two is complex given that it could be the disease in question that may cause reactivation of HHV, or that hospital protocols such as the use of steroids or other treatments may provide for a window of reactivation. There’s even some evidence to suggest that astronauts experience HHV reactivation during travel, which may be due to various stressors as well.2

All this to say that it wouldn’t be out of the ordinary for widespread HHV reactivation to occur amidst a pandemic brought on my SARS-COV2 infections and maybe even some of the stress caused by the lockdowns.

There’s a lot to cover here, so the following sections may lack some organization in order to provide a broad look.

HHV Reactivation and SARS-COV2 infection

• Gold, et al.3: In small investigation Gold, et al. noted that 20/30 people with long COVID had evidence of EBV reactivation compared to 2/20 control subjects (people infected with SARS-COV2 but did not show long COVID symptoms), suggesting that EBV reactivation may be a possible causative agent in long COVID.

  • Gold, et al. also includes findings from other studies noting high prevalence of EBV in COVID patients:

Chen et al. (2021) of Remnin Hospital at Wuhan University in Wuhan, Hubei province, China were the first to document finding EBV reactivation in COVID-19 patients during the acute phase. They found that 55.2% of hospitalized COVID-19 patients between 9 January 2020 and 29 February 2020 with serological confirmation of past EBV infection also tested positive for EBV VCA IgM, indicating EBV reactivation within two weeks of testing positive for SARS-CoV-2 [19].

Paolucci et al. (2020) tested 104 COVID-19 patients, 42 in an intensive care unit (ICU) and 62 in a sub-intensive care unit (SICU) in Italy and observed EBV reactivation in 95.2% (40/42) of the ICU patients and in 83.6% (51/61) of the SICU patients. They further determined that the median EBV DNA level in ICU patients was significantly higher than that of SICU patients [20]. A similar study in France found evidence of EBV reactivation in 82% (28/34) of COVID-19 ICU patients. Further, they found EBV reactivation to be associated with longer median ICU stays (15 days versus 8 days, p < 0.05) [21].

Lehner et al. (2020) ran EBV and cytomegalovirus (CMV) DNA tests on COVID-19 patients in the Medical ICU at the Medical University Innsbruck, Austria and found that 78% of the COVID-19 patients they tested with respiratory failure requiring invasive ventilation had evidence of EBV viremia [22]. However, CMV viremia was not found to be any more common in COVID-19 patients than in non-COVID-19 patients.

• Banko, et al.4: A systematic review of 36 publications examining HHV reactivation during COVID noted evidence of various HHV viral reactivations, with EBV showing the highest prominence, followed by HSV and CMV. Among those with severe COVID EBV reactivation was 6 times greater than non-COVID-19 controls.

  

Some pieces of literature noted a neurological component of HHV reactivation, possibly suggesting that some of the cognitive impairments and neurological issues seen in some patients may be due to HHV rather than SARS-COV2, although a possible synergistic effect should not be overlooked.

• Haddad, et al.5: A case report of 4 people with neurological complications following COVID infection, leading to two having encephalitis and the other two having encephalomyelitis, were found to have evidence of EBV/HSV-1 reactivation when CSF samples were analyzed. Only one patient showed evidence of SARS-COV2 RNA within the CSF, and only one showed severe pulmonary involvement with SARS-COV2. Overall, the presentation didn’t show neurological alterations due to hypoxia, and therefore it’s suggested that the neurological complications in these individuals were caused by HHV reactivation rather than SARS-COV2.

• Carneiro, et al.6: Among a small group of 53 COVID positive, hospitalized patients over 80% of patients were found to have had at least one HHV infection/reactivation, with HHV-6, CMV, and HHV-7 showing the highest detection rates. In particular, around 14 of the 53 patients (26.4%) showed neurological complications, with a significance being suggested in those who were HHV-6 positive. This study differed relative to other studies which noted EBV-prevalence as being a main driver of neurological complications, although the larger body of evidence seems to implicate all HHVs as being associated with neurological complications.

  • The authors provide some food for thought, again suggesting that the diagnosis of SARS-COV2-related neurological complications tend to overlap with HHV infections, and therefore may be mistaken.

In 26.4% of the patients, we observed CNS-associated neurological symptoms, such as impaired consciousness, headache, dizziness, acute cerebrovascular disease, and seizure. Similarly, a recent study confirmed SARS-CoV-2/HSV-1 coinfection in a patient with loss of consciousness, disorientation, and dizziness [9], which are symptoms suggestive of herpetic infection. EBV reactivation has also been associated with persistent symptoms observed in patients with COVID or long COVID,including some neurological manifestations, such as confusion and headache, which were observed in our patient group as well [42]. The most commonly detected herpesviruses in patients with neurological changes were HHV-6, CMV, and HHV-7. Although a statistically significant association between neurological changes and herpesvirus detection was only observed for HHV-6, CMV was also detected in several patients, and the reactivation of this virus is also associated with neurological changes in immunocompromised patients [20]. The immunosuppressive condition triggered by SARS-CoV-2 infection may play a role in reactivation herpesvirus, which may cause diffuse encephalitisand myelitis [20]. In addition, some patients were treated with corticosteroids, and we know that use of corticosteroids can trigger herpesvirus reactivation, studies have demonstrated the association between the use of corticosteroids and reactivation of CMV and HHV-6, which coincidentally also were the most detected herpesviruses in our study population [43]. Furthermore, our findings also suggested an association between neurological changes and HSV-1 detection in patients with a high SARS-CoV-2 load. In this group of patients, 33.3% (3/9) showed changes in the CNS and 22.2% (2/9) in the PNS. Given the strong association between HSV-1 reactivation and neurological changes, further investigation of this association is necessary.

• Lino, et al.: From a group of 173 patients suspected of having SARS-COV2 60 ended up testing positive while 13/60 SARS-COV2 positive patients were also positive for HHV-6B. However, the presence of HHV-6B did not correlate with increased mortality, although this may be due to the small sample size or to the strain of HHV-6 found. Nonetheless, the relatively high presence of HHV-6 was worth noting.

These are only a few of the articles I came across, and there are likely to be other articles that may refute or substantiate this association between HHV and SARs-COV2. Nonetheless, it’s important to notice that there’s an overlap in symptoms between these two viruses, especially given that Long COVID symptoms appear to overlap with chronic fatigue syndrome, suggesting that HHV reactivation may be overlooked as a possible culprit and may not be considered in many diagnoses and evaluations for Long COVID.

Note that in many of the cases above the proportion of HHV reactivation was heterogeneous and may come down to various factors such as age, comorbidities and other things of that nature. Thus, there’s likely to be a bit of unpredictability in determining which HHV, or if multiple, may reactivate. Unless otherwise prompted by dermatological signs narrow screening tests may be conducted which also may miss out on certain HHV species.

Why the overlap?

Given that HHV reactivation is rather common, the question remains as to whether reactivation is uniquely distinct with SARS-COV2 infection or whether this is coincidental. That is, is the course of the pandemic typical of other viral outbreaks, in which case with reported upticks in HHV reactivation and infection?

Unfortunately, I haven’t been able to find anything in the literature in regards to HHV reactivation during flu outbreaks. On the surface, this may suggest that the link is more complex than just any viral infection leading to reactivation, although it’s important to remember that this may, in part, be due to a lack of interest in finding a link between the two viruses.

HHV reactivation is also rather common in many different diseases, and strikingly in all sorts of organ failures of unknown etiology. We’ve seen that some cases of cardiovascular disease have been recognized, usually through biopsy, to correlate with the presence of HHV and other viruses, especially in cases in which the cause of the disease is unknown. This may occur with other organs as well, as indicated by a study from 2019 where it was found that around 22% (6 of the 27 samples taken) of liver samples taken from people who suffered acute liver failure with unknown etiology had detectable HHV-6.7

Evidence also seems to suggest that those with ARDS who are put on mechanical ventilation may show elevated rates of HSV and CMV reactivation, with HSV detection appearing to correlate with longer duration on ventilation in this one study.8

With all this being said, the presence and detection of HHV may not be associated with the disease being examined. It’s quite possible that all of these reactivations are a consequence of severe illness influencing viral reactivation, but resulting in the virus as acting nothing more than a bystander to the cellular havoc already occurring. Thus, HHV reactivation may just be one of many indicators that the body is not in a proper state.

However, to provide a caveat, I came across a case report in which it was determined that two hospital fatalities may have been associated with otherwise treatable HHV reactivation which was not caught in time.9

One patient was a 77-year old woman who complained of severe abdominal pain, with imaging noting gastritis and evidence of abdominal lymphadenopathy. Seven days after admission and worsening symptoms she developed a skin rash, which was noted to be positive for VZV (shingles) and was placed on an antiviral treatment, but unfortunately passed. The other case notes of a woman with T1 diabetes and Stage IV kidney disease who presented with toxic epidermal necrolysis syndrome, developed antibiotic-resistant Pseudomonas pneumonia, and later succumbed to her illness. Post-mortem examination found strange cytopathologies within the lungs, liver, trachea, and skin more akin to HSV cytopathology.

The authors note that the first case was not recognized until too late with the presence of a skin rash whereas the second case was not even considered until autopsy.

This may suggest that a causal factor for HHV reactivation may rely on differential diagnoses aside from PCR and other viral detection methods to infer a distinct pathology related to HHV. Clinicians and pathologists may overlook overlaps as being related to other etiologies aside from HHV reactivation, and so it’s quite possible that many of the signs and symptoms of SARS-COV2 may be due to misattribution, as is quite possible with Long COVID symptoms.

Much of this is a more broad discussion of HHV’s presence in other diseases. Again, the question is why SARS-COV2 may be more closely associated with HHV reactivation.

Unfortunately, there doesn’t appear to be any clear explanation. Some suggestions are that SARS-COV2’s induction of lymphocyte exhaustion or lymphocytopenia may allow room for viral reactivation.

I’m partially critical of COVAIDS narratives, although this dip in immune response with a SARS-COV2 infection does parallel the fact that HHV infections are commonly found in HIV patients and those with immunodeficiencies, so it’s quite possible that reduced adaptive immune function may provide a window for latent virus reactivation.

This also appears to be the case with interferon (IFN) production as well. Evidence suggests that SARS-COV2 may alter interferon responses, with evidence suggesting that autoantibody may be produced against interferon 1 in some patients with severe COVID.10

This parallels with evidence that some COVID critically ill patients who produce IFN autoantibodies show evidence of HHV infections11, providing additional evidence for immune dysfunction from SARS-COV2 allowing a window for HHV reactivation.

Keep in mind that hospital protocols may also contribute to HHV reactivation, as ventilation and even the use of corticosteroids may increase the risk of viral reactivation, although the latter is considered rather controversial.

So there still appears to be a lot of unknowns between SARS-COV2 and HHV reactivation, although evidence seems to suggest that this is an avenue worth considering when it comes to worse outcomes and Long COVID risk.

More importantly, it suggests that HHV may be overlooked as a possible contributor to SARS-COV2 outcomes, and quite possibly outcomes related to other diseases. Given the presentation of herpesviruses people may wait and check for dermatological signs of viral reactivation, but as noted in the case report above waiting for such a presentation may prove deadly, and in reality many autopsy reports may overlook other viral agents when it comes to myocarditis or sudden cardiac death in lieu of focusing on SARS-COV2 in particular.

With clear signs of people still suffering from Long COVID it also raises a question of whether clinicians are checking for possible HHV reactivation as one factor among many possible factors.

Like with everything, there are parallels that must be drawn between SARS-COV2 infections and vaccinations in order to figure out what commonality exists between the two that would explain HHV reactivation in both scenarios.

The next post will look more closely at some of the evidence of HHV reactivation post-COVID vaccination.

Substack is my main source of income and all support helps to support me in my daily life. If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Subscribe now

Share

Myocarditis and other pathologies of heart inflammation have become a hot button topic with good reason. As the COVID vaccines rolled out reports of myocarditis has raised serious concerns about the possible heart damage, both acute and lifelong, that may be occurring worldwide.

Unfortunately, all of this attention in regards to SARS-COV2 and vaccine-related myocarditis has led to these two agents in particular as being the main culprit for myocarditis and sudden cardiac deaths.

It may surprise readers that sudden cardiac death, and really viral myocarditis, has been around for many years, with a well-known virus family likely being a culprit- human herpesviruses.

The evidence has always been there since even before the pandemic that human herpesviruses, or HHV, have been associated with many forms of heart-related events, and indeed may be playing some of underlying role in the events that have transpired since the onset of the pandemic.

And again, we were made aware of this when there were frequent reports of shingles following COVID vaccination. It may be that phenotypic presentation of shingles via skin rashes made us more cognizant of this adverse reaction in particular, but underlying the shingles may have been other herpesvirus reactivations that have gone unnoticed or unchecked.

Consider that in last week’s post of a possible myocarditis “relapse” two teens presented with evidence of HHV-7 infection via PCR.

In this post I also made mention of the fact that a prior case series of vaccine-related cardiac death made mention of a possible HHV-6 infection in one of the deceased, with me at the time not really understanding the significance of this finding.

Upon first viewing all of this may seem coincidental as it’s only two case reports. However, upon digging a little deeper I believe there is more to this story, and possibly something that seemed to have been completely glossed over with a medical paradigm shift that focused on SARS-COV2 and vaccines alone.

That is, to what degree are many of these cardiac-related events related to possible HHV reactivation and infection rather than just a SARS-COV2 infection or event related to the vaccines?

There’s a lot to cover here, and I most certainly won’t get all of the details right, but we’ll explore the world of herpesviruses a bit here and go into possible connections between these family of viruses and the COVID pandemic.

Subscribe now

Much ado about herpes

Herpesviridae are a family of DNA-based viruses. Many different forms of this viral family are known, but only a select few are known to infect humans and are designated as human herpesviruses (HHV) and given a number, likely detailing order of discovery or close associations between viruses.

Most information on HHV is clouded by the fact that two viruses in this family are known to cause the sexually-transmitted disease of genital and oral herpes- Herpes simplex, or HHV-1 and HHV-2.

Their staying power is rather obvious due to their unsightly appearance, but this has led us to forget that nearly all humans have been infected with herpesviruses of some type.

For instance, the disease we know as chicken pox is caused by a herpesvirus called Varicella zoster (HHV-3). When reactivated the virus is categorized as Herpes zoster (still designated HHV-3) and presents as shingles.

There are other viruses within this family as well, such as Epstein-Barr virus (HHV-4) which causes mononucleosis, as well as human Cytomegalovirus (HHV-5) which also causes mononucleosis as well as pneumonia.

There are other viral species as well belonging to the Roseolovirus genus, although these viruses don’t appear to have a distinct name, but rather are classified as HHV-6 and HHV-7. Herpesviruses within this genus can cause a disease known as roseola infantum1, also called exanthem subitum, which is the onset of a sudden high fever which lasts days and may lead to an appearance of rashes near the end of the viral infection.

It’s been suggested that nearly 90% of adults show evidence of HHV-6 infection, and so it’s an extremely common infection that tends to go away on its own, usually occurring by the time someone reaches the age of 2. Although common and generally mild, evidence suggests that a good portion of infants may experience febrile-related complications including febrile seizures which occur in about 15% of infants infected.

One cancer-associated herpesvirus, HHV-8, has been associated with Kaposi sarcoma (cancer that lines blood vessels and lymph nodes) and is commonly known as Kaposi sarcoma-associated herpesvirus.

Tropism and Latency

Although rather common viruses, herpesviruses tend to show rather concerning features of cell/tissue tropism as well as latency.2

Tropism refers to a bias of viruses towards certain cell types. This is usually related to the specific type of surface proteins found on viruses and which host cell receptors they interact with. For instance, SARS-COV2 is argued to show tropism for cells bearing ACEII receptors since the spike protein can bind to these receptors.

For HHV their tropism is rather widespread. For instance, many show a clear tropism for epithelia given that they are highly infectious agents. Evidence also points to their ability to infect other organs and tissues as well.

However, some show specific tropisms, such as tropism for neurons (neurotropism). HHV-1→3, in particular, show tropism for sensory ganglion and can lie dormant within these cells.

The other human HHVs show tropism for lymphocytes including B and T-cells, monocytes, macrophages, natural killer cells, and other immune-related cells.

Surprisingly (or unsurprisingly), the discovery of HHV-6 was owed in part to those with HIV, as HHV-6 was discovered within the peripheral blood mononuclear cells (PBMC) of patients with AIDS as well as those with lymphoproliferative disorders. Epidemiological surveillance would later find both HHV-6 and HHV-7 as common viruses in healthy individuals as well.

There’s probably a longstanding story between these viruses, with even some evidence suggesting that HHV-7 may compete with HIV for binding to CD4+ lymphocytes and may even disrupt HIV infections.3 I suppose COVAIDS proponents should hedge their bets given that over 85% of the population show evidence of HHV-7 infection. In fact, there’s been a rather interesting relationship between HHV and HIV given that both are considered lifelong infections, as well as due to the fact that most HIV-positive individuals are coinfected with at least one HHV.4

Latency refers to a time period in which a virus infects and resides within host cells without leading to cell destruction or immunological responses. Essentially, the virus is somewhat “dormant” in this stage but may become reactivated if the timing and course of host events allow for an opening, such as in immunocompromised host which may not fend off reactivated viruses.

This process is rather complex and won’t be explained in great detail. Essentially, for some of these herpesviruses their genome gets contained and circularized into a structure called an episome. These episomes can reside within an infected cell’s nucleus, or they may tether themselves to chromosomes via a tethering protein.

Again, the events in this stage is rather complex and won’t be discussed in this post.

However, what’s rather interesting is that HHV-6 is suggested to have chromosomal-integration capabilities and can integrate into the telomeres of chromosomes, and even be passed on into future generations through inheritance.

This phenomenon, called inherited chromosomally integrated human herpesvirus-6 (iciHHV-6), appears to occur in 1% of the world’s population5 and is a phenomenon in which every cell type within a person’s body contains the genome for HHV-6 due to inheritance of this integrated virus from parents (Pantry, S. N., & Medveczky, P. G.6):

Chromosomally integrated HHV-6 has been reported both in vivo and in vitro, and integration into gametes can result in the inheritance of HHV-6 [36,41,42,43]. This condition, commonly known as inherited chromosomally integrated HHV-6 (iciHHV-6), occurs in approximately 1% of the human population worldwide and is considered the major mode of congenital HHV-6 transmission [42,44]. The inherited viral genome is passed on to subsequent generations in a Mendelian manner, and all iciHHV-6-positive individuals harbor one copy of the viral genome in every nucleated cell. As a result, these individuals exhibit a persistent high viral load (1 × 10⁶–1 × 10⁷ copies/mL) in whole blood, and hair follicles, leukocytes, and other clinical samples are also positive [42,45,46,47,48].

There’s been some conflicting evidence as to what this integration of HHV-6 may suggest. It’s been argued that iciHHV-6 may be inactive, although some evidence suggests that some people show persistent viral replication that may be the result of reactivation of the virus or due to a superinfection with a primary infection.

The role of iciHHV-6 in health outcomes is also conflicting. Some people seem to argue that icIHHV-6 carriers may be at increased risk of cytokine overproduction, cardiovascular risk, and other possible maladies. One study noted that iciHHV-6 carriers had a much higher incident rate of angina pectoris (chest pain), which may suggest a possibly greater risk of cardiovascular complications for these individuals.7 Another study suggests that iciHHV-6 carriers have a higher antibody response, which may come from occasional gene expression of HHV-6.8 The effects of this is unknown, although it wouldn’t be surprising to consider that a persistent, heightened immune response may trigger autoimmunity or other complications since host cells are expressing these gene products.

For some context, a case report from 20219 noted an event in which a 12-year old boy presented to the hospital days after experiencing headaches, vomiting, and eventually reduced mental status. He was later found to be hypotensive, febrile, and tachycardic, and was eventually diagnosed with multisystem inflammatory syndrome in children, or MIS-C.

Eventually, further testing suggested that the boy had iciHHV-6 and may have contributed to the MIS-C in this patient.

To that, the authors made the following remarks (Biswas, et al.):

To our knowledge, an association of MIS-C with iciHHV-6 has not been previously reported. Hyperinflammatory states similar to those seen in MIS-C are known to be associated with HHV-6 activation, including in patients with iciHHV-6. In addition, proapoptotic signals activate herpesviruses and retroviruses out of latency.^39,40  The end-organ dysfunction seen in MIS-C has substantial similarities to that seen in other hyperinflammatory states associated with HHV-6 activation,^20,34–36  so it is plausible that in some patients with MIS-C, HHV-6 activation could contribute to the pathologies associated with MIS-C. This single case may prompt an interest in additional studies of HHV-6 in patients with MIS-C, either iciHHV-6 or activation of conventional episomally latent HHV-6. If HHV-6 is a common feature in MIS-C, that observation would constitute another contrast between MIS-C and Kawasaki disease, in which high-level HHV-6 activation has not been commonly observed.

Again, this is more about some food for thought given the reports of MIS-C related to COVID. Although the evidence tying iciHHV-6 to other diseases is weak, it still raises some questions of how latent viral infections or even integrated viruses can influence our health.

Reactivation

Herpesviruses can come out of their dormant, latent stage and reactivate. The clearest example of this being the emergence of shingles in the elderly- a sign that HHV-3 has reactivated.

The factors that contribute to reactivation are multifaceted. The most common factor is immunodeficiencies as many of these herpesviruses reactivate in severe cases of AIDS. Other factors of immune dysfunction can also contribute to this reactivation. This may be owed to reduced immune function that cannot keep latent viruses at bay, allowing them a window of opportunity to reemerge and cause havoc.

Stress is also a likely component in reactivation given that HHV-1 and HHV-2 can re-emerge as flare-ups during stressful situations. Other infections, as well as drug-induced hypersensitivity, may allow for reactivation as well. Interestingly, some findings have suggested that helminth infections may lead to HHV reactivation by altering the body’s interleukin response, which again makes room for the virus to awaken from dormancy.

The immunomodulatory properties of certain nanoparticles may also influence herpesvirus reactivation. In short, many different pathways are likely responsible for HHV reactivation.10

In any case, what’s important to note is that there are many different triggers for HHV reactivation. Even the use of immunosuppressants or infections with other pathogens can induce reactivation, leading to secondary infections or even worse given the lymphotropic nature of some of these HHVs, which may suggest a double-hit, synergistic effect from coinfections with HHVs.

It’s something to consider given the pandemic and what widespread infection and vaccination may mean for reactivation.

Share

Herpesviruses, chronic fatigue syndrome, and sudden cardiac death?

Again, this article has highlighted a ubiquitous virus that readers have likely experienced at some point in their life.

And yet, these viruses appear to be associated with maladies that have gained far more attraction in recent years due to COVID, unfortunately leading to these viral agents being overlooked.

For instance, before SARS-COV2 was a “thing” there has been multiple pieces of literature implicating these viruses in post-viral syndrome and cardiovascular complications.

Several of these HHVs such as EBV has been implicated as possible drivers of chronic fatigue syndrome.11 A growing body of work is even suggesting that HHV-6 and HHV-7 may play a role in chronic fatigue syndrome as well.12,13,14

To put this into perspective, and something to consider for the next post, an article from Very Well Health published in early 2022 highlighted some long COVID haulers who were found to have reactivation of a host of HHVs, suggesting once again a possible link between the COVID pandemic, vaccines, and possible HHV reactivation. Again, food for thought for the next post.

Albeit controversial, there has also been some debate over whether HHV infection and reactivation may be associated with Alzheimer’s dementia as some of these latent viruses reside within the CNS, with some such as HHV-1→3 showing neurotropic properties in particular.15 Some of the arguments made are related to the antimicrobial nature of these amyloid plaques, and so reactivation of HHV may lead to seeding events and plaque formation as a method of dealing with viral reactivation, especially among the elderly and the immunocompromised. There’s also a possibility of neuroinflammation driving the dementia as well.16

A growing body of evidence appears to point towards HHV as being related to instances of myocarditis, heart failure and possibly sudden cardiac death, with greater attention being paid towards HHV-6 and HHV-7 in recent years. This is owed, in part, to assessments of endomyocardial biopsies for autopsy patients as well as those with idiopathic heart dysfunction where it was recognized that different viruses were present at the time of the cardiovascular incident, including HHV in some instances.

Andréoletti, et al.17 provides a bit of a summary on viral-related myocarditis:

In Europe and the USA, viral aetiologies largely prevail over other causes of myocarditis (Table 1). Coxsackie virus, parvovirus B19, HHV-6 type B and the adenovirus are the most frequent aetiological viral agents implicated in acute myocarditis in children or young adults (aged < 35 years) (Table 2) [19], [26], [27]. Human immunodeficiency virus and hepatitis C virus can be also aetiological agents of myocarditis [28], [29]. Recent data showed that it was possible to detect viruses in 67% of idiopathic left ventricular dysfunction cases using molecular techniques for the virological analysis of cardiac biopsy samples [27]. Co-infections were found in more than 12% of cases, generally HHV-6 plus parvovirus B19; HHV-6 seems to be an important cofactor in myocarditis caused by parvovirus B19 [27]. Other viruses, such as the Epstein-Barr virus or cytomegalovirus, are also associated with this pathology after heart transplantation [30].

I’ve mentioned a few reports of HHV being associated with myocarditis in the “relapse” myocarditis article including one article that Andréoletti, et al. cites above (Citation 27).18

This information may surprise some readers, but all of this suggests that SARS-COV2 wasn’t the first virus to show possible risk of heart inflammation.

There have been a few case reports of myocarditis-related severe injury and death owed to HHV infection/reactivation.

One very recent case report notes of a 40-year old woman who got ill at a family event (many other attendees were infected as well), eventually leading to complications such as myocarditis. The woman eventually needed a heart transplant.19

A 2001 case report20 notes of an 11-year old boy who died from a fatal case of myocarditis owed to a HHV-6 and Parvovirus B19 coinfection. The authors suggest that the immunosuppressive nature of HHV-6 may have exacerbated the coinfection, ultimately leading to the unfortunate death.

Reactivation of HHV has been implicated in some myocarditis deaths as well, including a Japanese man who was put on steroid therapy for a severe case of acute hepatitis, with the immunosuppressive nature of the steroids likely worsening or causing the fatal myocarditis.21 Another case report notes of two children (one 13 and one 2) who were immunosuppressed and suffered fatal myocarditis brought on by possible HHV-6 reactivation.22

So again, SARS-COV2 is not the only virus to be associated with myocarditis. In fact, it appears that we have a common family of viruses that have been associated with myocarditis and sudden cardiac death for years, with not much attention being payed towards these viruses.

However, with the onset of the pandemic a lot of this prior knowledge and information may have been overlooked in lieu of a “novel” pathogen.

Consider this case report23 of a differential, post-mortem diagnosis of fulminant myocarditis which was considered to be associated with HHV-6 rather than SARS-COV2.

The patient, like all other myocarditis patients, presented with similar symptoms:

A 59‐year‐old man was admitted to the hospital for fever and dyspnea for 3 days, resistant to therapy with antibiotic and antipyretic. His medical history showed hypertension and obesity. At admission, the clinical examination revealed: temperature of 37.7°C, heart rate of 115/min, blood pressure of 120/85 mmHg, oxygen saturation 93%, bilateral decreased breath sounds, and lower right leg reddened.

The patient tested negative for SARS-COV2 twice, and after worsening symptoms eventually died of sudden cardiac arrest.

When RT-PCR and immunofluorescence staining was conducted on myocardial samples HHV-6, rather than SARS-COV2, came up as a possible culprit:

The real‐time polymerase chain reaction (RT‐PCR) has been obtained from several frozen myocardial samples for the most common cardiotropic viral genomes, including CMV, EBV, HHV‐6, enterovirus, and SARS‐CoV‐2. All tests were negative, except for HHV‐6, which gave positive results on the myocardial sections. The RT‐PCR result has been confirmed by immunofluorescence analysis (Figure S3).

Because of the lack of autopsy reports and this focus on SARS-COV2 it’s possible that other causes of myocarditis may have been overlooked.

In that regard, the authors conclude with the following:

Macroscopic and microscopic findings demonstrated that the fatal outcome was due to an HHV‐6 related fulminant myocarditis. The patient presented clinical signs and symptoms consistent with a lot of viral infections, including COVID‐19. If it is true that during the pandemic is important to exclude SARS‐CoV‐2 infection, particularly in patients with a suspicious clinical picture, remember that clinical signs are very similar to a lot of viral infections is equally so. Myocarditis is not only caused directly or indirectly by SARS‐CoV‐2, ⁴ but also by a lot of cardiotropic viruses that have to rule out. ⁵ In other words, in patients with suggested signs of viral infection, it is crucial to get screenings for all potentially causative pathogens. In the case at hand, the clinical course of fulminant myocarditis was, as usual, rapidly progressive and in just a few hours culminating in a fatal outcome. Consequently, the cause of death and the differential diagnosis of COVID‐19 and other cardiotropic viruses were demonstrated by post‐mortem examination.

---

All this to say that we may have overlooked a critical component in regards to the pandemic and cases of myocarditis. It’s more than likely that these HHVs have played some sort of role within the pandemic, which either has been downplayed or overlooked.

Keep in mind that this doesn’t excuse SARS-COV2 or the vaccines. Rather, there may be something more going on, especially given the reported cases of viral reactivation post-SARS-COV2 infection as well as vaccination.

More will be explored in the next post.

Substack is my main source of income and all support helps to support me in my daily life. If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share

Share

I’ve seen growing discussion around this recent case report1, which notes “relapse” of myocarditis in two male teens months after experiencing myocarditis right after receiving COVID vaccines.

I put relapse in quotation marks because I don’t think these case reports are clear indicators of a sudden occurrence of myocarditis.

In short, the case report highlight two male teens (15 and 16, respectively) who experienced myocarditis within days of receiving the second dose of a Pfizer/BioNTech vaccine.

The overall time course of myocarditis and supposed relapse are noted below:

The first patient was argued to be “healthy”, but I remind readers that I’ve grown more hesitant when studies make such comments due to how subjective health is measured in studies.

The second patient had a noted history of asymptomatic ventricular monomorphic extrasystoles, also called premature ventricular contractions, which is a benign condition in which the lower chambers of the heart may beat more frequently than normal, causing a sensation of the heart fluttering. This patient is also noted to be obese with a BMI of 31 (in contrast to patient 1 having a BMI of 18) at the point of hospitalization.

There’s a concerning number suggesting a BMI of 48 for patient 2 and 29 for patient 1 (Table 1), which may suggest that the patients gained weight by the time of their follow-up (my assumption, although it was noted that patient 2 was given clearance to participate in sports after follow-up).

I won’t highlight the clinical presentation and the follow-up, although in both cases it didn’t appear that both patients fully recovered as most mainstream outlets tend to report. Patient 1 still showed evidence of late gadolinium enhancement at the 6-month follow-up as well as persistent focal lesions.

Interestingly, both patients showed evidence of anti-endothelial autoantibodies, although there appears to be inconsistencies in this reporting. For instance, patient 1 was noted to have evidence of anti-endothelial autoantibodies during the first episode with no indication of autoantibodies during the second (note- they didn’t mention it, not that there was no evidence of autoantibodies). In contrast, patient 2 was noted to show evidence of both anti-heart and anti-endothelial autoantibodies during the 2nd episode with no remarks about the 1st episode. There isn’t any indication of what tests and which antibodies were checked for as well. It may be that clinical evaluations may have missed out on these tests, but it unfortunately suggests that there’s some information that’s missing.

In regards to these findings the authors make a comment that they are unsure what these autoantibodies may entail. They make the following comment which cited another article that seems to be gaining traction again:

These autoantibodies might be innocent bystanders resulting from myocardial inflammation and injury, or might reflect a certain immune–genetic background that predisposes to developing hyperimmunity and myocarditis upon any trigger. However very recent findings in post mRNA vaccine myocarditis did not show evidence of cardiac targeted autoantibodies in these patients suggesting that this mechanism is unlikely to act as main pathogenic trigger [18].

The study referenced is the Barmada, et al.2 study I wrote about a while back in which I noted that I don’t consider the study to be a full refutation of autoimmunity hypotheses, so I’m a bit skeptical of this comment.

When looking specifically at the 2nd episodes there appears to be something interesting which most people seem to have overlooked. In this case, the authors note that both patients had evidence of human herpesvirus 7 (HHV7) present during the 2nd myocarditis presentations.

For patient 1:

Quantitative antigenic nasal swab for SAR-CoV2 resulted negative while the complete viral PCR evaluations, as previously described, showed residual copies for HHV7 (1124 copies/ml). On CMR new focal lesions along the LV wall with edema and LGE were observed. Altogether, these data were consistent with relapsing of acute myocarditis. Considering the myocarditis recurrence and HHV7 positivity, high dose intravenous immunoglobulins (IVIG) were administered along with angiotensin-converting enzyme (ACE) inhibitors with rapid improvement of clinical conditions and cardiac enzyme values.

Patient 2 was also noted to have evidence of HHV7 at the 1st clinical presentation:

The broad viral evaluations showed positivity for HHV7 (1750 copies/ml).

As well as the 2nd clinical presentation:

Nasal swab for SARS-CoV2 was negative. Serological and PCR virological screening demonstrated few copies of HHV7 (<500 copies/ml).

At first, this may not appear to mean much, and in a prior article on autopsy reports of myocarditis post-vaccination I mentioned that 1 of the autopsies noted the presence of human herpesvirus 6 (HHV6):

However, there appears to be evidence of human herpesvirus being associated with various forms of viral myocarditis.

For instance, an article published in 20063 noted one strain of parvovirus as well as HHV6 as being large contributing factors in viral myocarditis.

Another article from 20174 noted an outbreak of myocarditis among pediatric patients who were diagnosed in a small-town hospital, which appeared to correlate with HHV7 infections.

What all of this tells us that there may actually be some more to these cases of myocarditis that may not have been recognized beforehand.

There’s quite a few lines of thought we can follow, but here are a few that this case report has got me thinking about:

1. These two cases may not be examples of “myocarditis relapse”, but instead a case of a second episode of myocarditis triggered by an HHV infection. However, it’s quite possible that the first instance of myocarditis may have compromised the heart, in which case the greater risk of viral myocarditis may have led to these second episodes.

2. Given that patient 2 was noted to have a possible HHV7 infection at the time of the first presentation it’s possible that a concurrent viral infection at the time of vaccination may also contribute to myocarditis in some way, possibly due to the multiple burdens placed on the heart. This may explain the positive HHV6 PCR finding highlighted in one autopsy report by Schwab, et al.5 and may provide an explanation for myocarditis that has yet to be explored. Note that there’s growing evidence associating pediatric infection with HHV6 and cardiomyopathy.6

   1. Case reports of myocarditis may only check for infection with SARS-COV2 and not other viruses. If so, that would mean that underlying viral infections may be overlooked to a large degree.

The authors note this in regards to HHV infections:

As noted in previous studies. viral infections could act as a trigger in a predisposed individual. Our cases show a new diagnosed HHV7 infection during the second episode and a persisting viral replication respectively with the second patient presenting symptoms compatible with an ongoing upper airway viral infection. HHV-7 has been recently described in association with severe myocarditis as potential causative agent [19]. The presumptive viral etiology of the second episode of myocarditis supported the choice to administer IVIG as suggested by international guidelines in association with supportive care [20], [21]. Since HHV-7 infection generally occurs during childhood and up to 95% of adults are seropositive [22], it can be considered an endemic virus and we cannot establish if HHV-7 detection is incidental or represent the causative agent of myocarditis. However, the rapid reduction of HHV-7 copies after their initial detection is more in favor of an incidental finding in this case.

Given all of this the conclusion of “relapse” myocarditis here may be a bit improper. Unless these second episodes can be directly tied to the first it may not be appropriate to consider these relapses, but rather myocarditis caused by other factors that may be influenced by the episodes of vaccine-related myocarditis.

No matter which way it’s examined it’s rather obvious that messaging on myocarditis has tended to downplay the severity of myocarditis as just being transient in nature and leading to full recoveries.

What may be the case is that one incidence of myocarditis may increase the risk of further cases down the line. In that regard, the cases of vaccine-related myocarditis may increase the risk of myocarditis from other sources, including myocarditis from other viral sources.

There are several avenues that have yet to be explored, and even with limited data it’s a rather bold assumption for medical authorities to make in suggesting that the myocarditis these children experience won’t cause further problems in the future.

It’s also apparent that these children diagnosed with myocarditis are also dealt a heavy blow to their childhoods in which they may be limited to any sort of physical activity for months at a time. If the numbers from Table 1 are proper, it suggests that both adolescents showed a drastic increase in BMI by the time of follow-up or 2nd episode, which may also contribute to cardiovascular issues and worse health outcomes as well. So even if the vaccine-related myocarditis may not contribute to greater risk of myocarditis in the future these children may be harmed in one other way by inhibiting their ability to be children and be physically active.

So there’s a bit with these case reports that need further explaining. The authors don’t note whether these patients received a booster prior to the 2nd episodes. Nonetheless, this report at least suggests that greater surveillance should be done not for just myocarditis but any subsequent cases of myocarditis in the future.

Substack is my main source of income and all support helps to support me in my daily life. If you enjoyed this post and other works please consider supporting me through a paid Substack subscription or through my Ko-fi. Any bit helps, and it encourages independent creators and journalists such as myself to provide work outside of the mainstream narrative.

Subscribe now

Share